ID: 1159793241

View in Genome Browser
Species Human (GRCh38)
Location 18:72810658-72810680
Sequence TGTGTCTTAAGCAGAATTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 179}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159793241 Original CRISPR TGTGTCTTAAGCAGAATTGT AGG (reversed) Intronic
905102521 1:35537460-35537482 TGTAAATTAAACAGAATTGTAGG + Intronic
905249226 1:36637374-36637396 TGTGTGGTAGGCAGAATTCTGGG + Intergenic
908280878 1:62533616-62533638 TGTGTTCTAAACAGAACTGTAGG - Intronic
909906547 1:81202608-81202630 TCTGTTTTAATCCGAATTGTAGG + Intergenic
910175574 1:84426907-84426929 GGTGTTTAAAGCAGAATTGAAGG + Intergenic
910209859 1:84782061-84782083 TGTGTCTTTAGCCGAAGAGTTGG - Intergenic
910495684 1:87824824-87824846 TATGTGTTACGCAGAATTTTGGG - Intergenic
911249199 1:95556318-95556340 TGTCTCAAAAACAGAATTGTGGG - Intergenic
912254110 1:108041522-108041544 TGTTCCTTAAGCAGAATTTCTGG - Intergenic
914142646 1:144964644-144964666 TGTGTCTTAAGCATAGTTCAAGG - Intronic
914237935 1:145829332-145829354 TTTGGCTTAAGCAGAAATGGTGG - Intronic
914799898 1:150953220-150953242 TGTGTCTAAAAAAAAATTGTTGG + Intronic
915034747 1:152912197-152912219 TGAGTCTGGAGCAGAAGTGTAGG - Intergenic
917119867 1:171636075-171636097 TGTGTCATAAGCAAAGTTGACGG + Exonic
917175389 1:172229203-172229225 TGTGAATTAAGCATAATGGTTGG - Intronic
917590256 1:176469227-176469249 TTTCTCTTAAGCCTAATTGTTGG + Intronic
923460370 1:234204865-234204887 TTTGCCTTAAGCAGGATTTTGGG + Intronic
1063915804 10:10880762-10880784 TTTGTCTTAACCAAAATAGTTGG + Intergenic
1069153466 10:64995982-64996004 TATTTCTTAATCTGAATTGTAGG - Intergenic
1070232761 10:74587549-74587571 AGTGTCTTCAGCAGAAATTTGGG - Intronic
1072249711 10:93572083-93572105 TGTGTATTAGGCAGAATTCTAGG + Intronic
1074419159 10:113293896-113293918 GGTGTCCCACGCAGAATTGTTGG - Intergenic
1074852914 10:117453254-117453276 TGTTTCTTAAGCTGAATGGTGGG + Intergenic
1076135592 10:128043692-128043714 TGTGTGTGTTGCAGAATTGTAGG + Intronic
1077270167 11:1673382-1673404 AGTGACTTAAGCAAAATAGTAGG - Intergenic
1077757011 11:5042288-5042310 TATGTCTCAATCAGAATTCTTGG - Intergenic
1077959055 11:7053509-7053531 TATGTCTACAGGAGAATTGTAGG + Intronic
1078999159 11:16736464-16736486 TATTTCTTCACCAGAATTGTTGG - Intronic
1080479892 11:32636937-32636959 TGTGTGTAAAGCATATTTGTAGG - Intronic
1080562849 11:33479728-33479750 TGCGTTTTTAGCAGAATTGTTGG + Intergenic
1083747997 11:64745711-64745733 TGTGTCTGAAGCCAAATGGTCGG - Intergenic
1086287581 11:85266800-85266822 TGTTTCTTCATCAGAATTGAGGG - Intronic
1087395248 11:97589034-97589056 GTTTTCTTAAGCAGAATTGGAGG + Intergenic
1089002699 11:115065383-115065405 TGTGTCTTCAGCAGAGCTGGGGG + Intergenic
1090748951 11:129729330-129729352 TGTGTCTGAAGCAGAACTCCAGG - Intergenic
1091924229 12:4331370-4331392 TGTGAGTTAAGCAGATTTGGTGG + Intronic
1092917751 12:13203530-13203552 TTTGCCTTTAGCATAATTGTTGG + Intronic
1093870386 12:24284244-24284266 TGTGTCTAAAGCAGAGTGGCTGG - Intergenic
1096904439 12:54921455-54921477 TGTGTCTTCAGAAGAAATGATGG + Intergenic
1104901928 12:132194131-132194153 TGTGACTTAAACAGTATGGTTGG + Intergenic
1112910012 13:104470545-104470567 TGTATCTTAAACATAATTTTAGG + Intergenic
1113141666 13:107159099-107159121 TGTGCCTTTTGCAGAAATGTTGG + Intergenic
1115632030 14:35254831-35254853 TGTGACTCAAGCAGAGGTGTGGG - Intronic
1116298671 14:43147107-43147129 GGTATATTAAGCATAATTGTAGG + Intergenic
1116612373 14:47092391-47092413 TCTTTCTTATGCAGAATTTTTGG + Intronic
1125239273 15:37554745-37554767 TGTGTTTGATGCAGAATTTTAGG - Intergenic
1127662946 15:61117212-61117234 TTTGTTTTAATCAGATTTGTTGG - Intronic
1128981102 15:72186644-72186666 AGTGTCTTAAAGGGAATTGTTGG - Intronic
1136079688 16:27843690-27843712 TGTGTCTGAAGCAGACTTTGTGG + Intronic
1139054115 16:63160733-63160755 TGTATCTTCAGTAGAATTGTGGG + Intergenic
1139793919 16:69466304-69466326 TGTTTTTTAAGTAGAAGTGTTGG + Intergenic
1143875920 17:9990688-9990710 TGTGGCTGAAGAGGAATTGTGGG + Intronic
1144414142 17:15030344-15030366 TGTGTATTTAGCAGAATGTTAGG - Intergenic
1144748862 17:17634408-17634430 TGTGTTTTAAGCTGCAATGTGGG + Intergenic
1147347611 17:39812779-39812801 TGTCTGTTAAGCAGTAGTGTTGG - Intronic
1149395672 17:56239842-56239864 TGTGACTCTAGCAGAGTTGTGGG + Intronic
1150129538 17:62659947-62659969 TGTGTGTCAGGCAGAACTGTAGG + Intronic
1150975116 17:70077144-70077166 TGTGGCTGAAGCAAAATTGCAGG + Intronic
1151172823 17:72262004-72262026 TTTTTCTTAAGCAGTATTGGAGG + Intergenic
1155686662 18:28561193-28561215 TATTTATTAAGCAGACTTGTGGG + Intergenic
1156764323 18:40632906-40632928 TATGTCATTAGCAGAATTGTTGG + Intergenic
1157214154 18:45768371-45768393 TGTTTCTTAATCAGAATTTGGGG - Intergenic
1158011580 18:52734833-52734855 AGGGATTTAAGCAGAATTGTAGG + Intronic
1158052493 18:53240349-53240371 TATGTCTTATCAAGAATTGTGGG + Intronic
1158887490 18:61842166-61842188 AATGTCATAAGCAGAATTGCTGG - Intronic
1159793241 18:72810658-72810680 TGTGTCTTAAGCAGAATTGTAGG - Intronic
1161044118 19:2125700-2125722 TGTATTTTAAACAGAAATGTAGG + Intronic
1161740545 19:6018522-6018544 GGTCTCTTAAGCCGAATTGCAGG + Intronic
1164502046 19:28828371-28828393 TGTGTGATCAGCAGAATTCTCGG - Intergenic
1165361757 19:35341224-35341246 AGTGTCTTCAACAGAATTGAGGG + Intronic
1165561780 19:36686658-36686680 TGTCCCTTAAGCAGAGTTCTGGG - Intergenic
926208769 2:10853440-10853462 CGTGTCTGAAGCAGAAATATTGG - Intronic
927667045 2:25040183-25040205 TTTGTGTTGAGCAGAATTGTGGG + Intergenic
928155389 2:28871544-28871566 TGTTTCTAACACAGAATTGTTGG - Intergenic
929005807 2:37391821-37391843 AATGTCTGAAGCAGATTTGTGGG - Intergenic
929777980 2:44940352-44940374 TGTGATTTACGCAGATTTGTCGG - Intergenic
931659117 2:64541594-64541616 TATGACTCAAGCAGAAATGTAGG + Intronic
931881131 2:66572171-66572193 AGTGTCTTAAGGAGACTGGTAGG + Exonic
933569766 2:83995862-83995884 TGGTCCTTATGCAGAATTGTTGG - Intergenic
933662044 2:84935865-84935887 TGAGGCTTAACCAGAATTGGTGG + Intergenic
936590374 2:113798008-113798030 TGTGTTTTACCCAGTATTGTGGG - Intergenic
939494951 2:142916822-142916844 TGTGACTTAACCAAAATTTTGGG + Intronic
939658556 2:144858705-144858727 TGGGTCTTGAGCAGAATTTGGGG - Intergenic
940710543 2:157157909-157157931 TGAGTTTTAAACAGTATTGTTGG - Intergenic
942404111 2:175634888-175634910 TGTGTCTTAGGCAGGCTTCTGGG - Intergenic
942707323 2:178790979-178791001 TATGTATTAAGCACAAGTGTAGG - Intronic
944912524 2:204324369-204324391 TGTGCCTCAAGCAGCATGGTGGG + Intergenic
945983585 2:216336833-216336855 TTTATTTGAAGCAGAATTGTTGG - Intronic
946717798 2:222571651-222571673 TGTGTGTGAAGCTGCATTGTTGG - Exonic
947183649 2:227434980-227435002 TGTTTCTTTAGAAGAAGTGTGGG + Intergenic
1169063813 20:2681229-2681251 TGTATCTTAATCTGAATGGTTGG + Intergenic
1169076239 20:2761253-2761275 GGTGGCTTGAGCAGCATTGTGGG - Intergenic
1169987369 20:11460509-11460531 TGTGTCTAAGGAGGAATTGTAGG - Intergenic
1174332256 20:49829736-49829758 CTTGTCATCAGCAGAATTGTGGG - Intronic
1174371014 20:50087517-50087539 TGTGCCTGAAGGAGAATTGCTGG + Intronic
1175070824 20:56332409-56332431 TGAGTTTTAAGCAGAATGGGTGG + Intergenic
1180797342 22:18612280-18612302 TGAGGCTTCAGCAGAAATGTTGG + Intergenic
1181224380 22:21382992-21383014 TGAGGCTTCAGCAGAAATGTTGG - Intergenic
1181254252 22:21551821-21551843 TGAGGCTTCAGCAGAAATGTTGG + Intronic
1182279692 22:29210534-29210556 TGTCTCTTAAAAAAAATTGTTGG - Intronic
1182849976 22:33465380-33465402 TTTGTCTTAAGCTGGATGGTGGG + Intronic
949644073 3:6072953-6072975 TATGACTTAAGCAGAATTTTTGG - Intergenic
949818107 3:8083915-8083937 TTTGTCTTACGCAGTATTTTTGG + Intergenic
950931657 3:16795468-16795490 AATGCCTAAAGCAGAATTGTTGG - Intergenic
952794798 3:37229311-37229333 TTTGTCTTAAGCAGAGTTTCTGG - Intergenic
953778682 3:45845639-45845661 AGTGTCTTATTCAGAAATGTGGG + Intronic
954101774 3:48379012-48379034 TTTGTCTTTAGAAGAATTGCTGG - Intronic
955196774 3:56811701-56811723 TTTGGTTTAATCAGAATTGTGGG - Intronic
959806606 3:110562130-110562152 TTTTTCTTAAGCAGAAGTGCTGG + Intergenic
960781892 3:121329282-121329304 TGTATTTTAAGAAGAATTGCAGG - Intronic
961055313 3:123783194-123783216 AGTGTCAAAAGCAGAATTCTTGG + Intronic
962126780 3:132627812-132627834 TGTGGGTTAAGCAGAATTTCTGG + Intronic
963211555 3:142698157-142698179 TTGGTCTGAATCAGAATTGTGGG - Intronic
964133349 3:153315560-153315582 TGTTTCTTAAGCTGATTGGTGGG - Intergenic
964212027 3:154239337-154239359 TGTGTATGAAGAAGTATTGTTGG + Intronic
966020137 3:175199508-175199530 TGTGCCTTATGCACTATTGTAGG + Intronic
966486823 3:180480224-180480246 TCTGTCTTAAGGAAAATTGGGGG + Intergenic
966568981 3:181418810-181418832 TGTGACATAGTCAGAATTGTAGG - Intergenic
970383183 4:15529019-15529041 TGTATCTGAATCAGAATTGCTGG - Intronic
974052620 4:56955215-56955237 ATTTTCTTAATCAGAATTGTGGG + Intergenic
975667319 4:76745243-76745265 TGTCTCTAAGGCAGAAATGTTGG - Intronic
976027815 4:80711834-80711856 TGTCTCTTAAGCATACTTGGAGG - Intronic
977655001 4:99510777-99510799 TGTTCTTTAAGCAGAATTGTGGG + Intergenic
978569709 4:110123388-110123410 TGTGTGCTAAGCAGAGTTCTAGG + Intronic
979077506 4:116291606-116291628 TTTGTCTTAAGCAGTAGTATAGG + Intergenic
980795576 4:137678185-137678207 TGTGTTTTAATCAGGATTCTGGG - Intergenic
981312142 4:143307710-143307732 TGTGGCATGAGCAGATTTGTTGG - Intergenic
982182192 4:152759051-152759073 TGGATCATAAGCAGAATAGTGGG - Intronic
984012717 4:174389892-174389914 TTAGTCTCAAGCAGAATTTTTGG + Intergenic
984738794 4:183138815-183138837 GTTGTCTTAAGCAGGATTGTTGG + Intronic
986763071 5:10897643-10897665 TGTGTCTTAGGAAGAATAATTGG + Intergenic
986926503 5:12759260-12759282 TGTGTCTCAAGCAAAACTTTAGG - Intergenic
987036431 5:14023624-14023646 TGTGTCTTAACCCCAATTCTTGG + Intergenic
987111131 5:14688117-14688139 TTTTTCTGAAACAGAATTGTAGG + Intronic
990369683 5:55104780-55104802 TGTCACTTAGGCAGAATTCTTGG + Intronic
991175652 5:63684899-63684921 TGTGTGCTATGCAGAATTATAGG + Intergenic
992795323 5:80250704-80250726 TGTGTTTTAAGCTGCATTATAGG + Intronic
993080813 5:83297686-83297708 TGTGACTTAAGTATAATAGTAGG + Intronic
994912973 5:105937076-105937098 TCTGCCTTAAGAAGAAATGTTGG - Intergenic
998538445 5:142956070-142956092 TTGGTATTAAGCATAATTGTGGG + Intronic
999040355 5:148402923-148402945 TGTGTTTTAAGCATTATTCTAGG + Intronic
999097880 5:148997006-148997028 TGTTTCTTATGCATAAATGTTGG - Intronic
1005667168 6:28069745-28069767 TGTCTTTTAAGCAGAAGTGAAGG + Intergenic
1006118385 6:31788199-31788221 TGTGTATTTAACAGAACTGTTGG + Intronic
1006936860 6:37724603-37724625 TGTGTCTTAAGTATAAGTGCTGG + Intergenic
1008586777 6:52957834-52957856 TATTTCTTAAGCAGAATTAGTGG + Intergenic
1008870193 6:56263689-56263711 TTTGCCTAAAACAGAATTGTGGG - Intronic
1009429938 6:63554951-63554973 TGTGTTTTTAGCAGCAATGTCGG + Intronic
1009864987 6:69386389-69386411 TGTGTCTAAAGGAGATTTCTGGG - Intronic
1012543341 6:100388907-100388929 TGTGACTTAAGCAGGTGTGTGGG - Exonic
1014803963 6:125808463-125808485 TGTGTCTGCAGCAGAATACTTGG + Intronic
1015156007 6:130096968-130096990 TGTGCCTTGGGCAGAGTTGTTGG + Intronic
1016218890 6:141640682-141640704 TGTATCTTAAGAAGCACTGTGGG + Intergenic
1020443711 7:8246420-8246442 TGTGTCTAAGGCAGAAATATAGG + Intronic
1027617496 7:80441753-80441775 TGTATCTCAAGTGGAATTGTAGG - Intronic
1028130268 7:87163341-87163363 TCTTTTTTAAGCAGAATTTTTGG - Intronic
1028453809 7:91016622-91016644 CAGGTCTTAAGCAGAATTGTAGG + Intronic
1030585053 7:111407303-111407325 TGTCTCTTAGGCAGATTTCTAGG - Intronic
1032906511 7:136373721-136373743 TGTGTCTTAAGTATTATTTTTGG + Intergenic
1035249575 7:157588134-157588156 TGTTTCTAAACCAGAAATGTAGG - Intronic
1036306874 8:7609486-7609508 TGTGTTTGAAGAAGAATTCTAGG - Intergenic
1036357724 8:8057474-8057496 TGTGTTTGAAGAAGAATTCTAGG - Intergenic
1036893225 8:12609472-12609494 TGTGTTTGAAGAAGAATTCTAGG + Intergenic
1037336217 8:17794753-17794775 GGTGACTTAATCAGAATTCTGGG + Intronic
1038648954 8:29385157-29385179 TGTTTCTTAAGAAGATGTGTGGG + Intergenic
1039339153 8:36627831-36627853 TGTGTGTTAAGCACTATTCTTGG + Intergenic
1041407408 8:57515403-57515425 TGTGACTTAAGCACAATTCCAGG + Intergenic
1042443884 8:68861240-68861262 TCTGTCTTAAGGAAAATTGGTGG - Intergenic
1045208043 8:100064165-100064187 GGTGTCTTAAGAAGGATTCTGGG + Intronic
1045418515 8:101991078-101991100 TGGGTCTTAAGCAGAAACGAAGG + Intronic
1046546354 8:115655408-115655430 TGTGTCCAAAGCAGAATAGATGG + Intronic
1047307739 8:123666620-123666642 CGTGTCTTCAGCAGAGCTGTGGG + Intergenic
1051259637 9:15250437-15250459 TTTGTCTTAAGGAAAAATGTAGG + Intronic
1051320244 9:15895720-15895742 AGTGACTAAAGCAGAATTGTGGG - Intronic
1053373106 9:37579241-37579263 TGTGTCTTAAAATAAATTGTTGG - Intronic
1055181312 9:73390190-73390212 TTTGTATTAATAAGAATTGTTGG + Intergenic
1056457384 9:86773807-86773829 TTTGTCTTCAGAAGAATTCTAGG + Intergenic
1059033678 9:110730124-110730146 TGTCTCTTGAGCAGACTTGCAGG - Intronic
1061937379 9:133865482-133865504 TGTGTCTTAAACAGTAGTCTAGG - Intronic
1186827747 X:13358164-13358186 TGTGTCTTATGCTGGATTCTTGG + Intergenic
1187260955 X:17684820-17684842 TGTGTGATAGGCAGAATTTTAGG - Intronic
1187678945 X:21746809-21746831 TGTTTCATTAGCATAATTGTAGG + Intronic
1187736567 X:22311025-22311047 TGTTTCTTATGCAGCATTATTGG - Intergenic
1191953184 X:66616620-66616642 TCTGTCTTAGGCAGAATGGGAGG + Intronic
1193422518 X:81299592-81299614 TGTTTCTTAATCAGTTTTGTTGG - Intergenic
1194692790 X:97008662-97008684 TGTGGCTTTTGCAGACTTGTAGG + Intronic
1195493029 X:105495667-105495689 TGTGTCTTAAGGCTGATTGTTGG + Intronic
1196680829 X:118467811-118467833 TGAGTCTTTCACAGAATTGTTGG + Intergenic
1196895520 X:120331832-120331854 CGGGTCTGTAGCAGAATTGTGGG + Intergenic
1198444270 X:136695864-136695886 TGTTTCTTAAGCTGAATAGTGGG + Intronic
1199299001 X:146190988-146191010 TGTCTCTTATGGATAATTGTGGG + Intergenic
1200341271 X:155399124-155399146 TGTGTTTTAACAATAATTGTGGG + Intergenic