ID: 1159795646

View in Genome Browser
Species Human (GRCh38)
Location 18:72840012-72840034
Sequence CTATAAGACAAGCTACAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 559
Summary {0: 1, 1: 0, 2: 5, 3: 46, 4: 507}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159795646_1159795649 23 Left 1159795646 18:72840012-72840034 CCTCTCTGTAGCTTGTCTTATAG 0: 1
1: 0
2: 5
3: 46
4: 507
Right 1159795649 18:72840058-72840080 TAATTCCTTTGAAAACAGTATGG 0: 1
1: 0
2: 3
3: 40
4: 373

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159795646 Original CRISPR CTATAAGACAAGCTACAGAG AGG (reversed) Intronic
901250519 1:7775306-7775328 GTAAAAGACAAGCCACAGAATGG - Intronic
901260955 1:7870318-7870340 CTACAAGCCAAGCTCAAGAGAGG + Intergenic
902976589 1:20092998-20093020 CTATAAGCATATCTACAGAGGGG + Intergenic
903903750 1:26668366-26668388 CTATAATCCCAGCTACACAGGGG - Intergenic
904816577 1:33206640-33206662 CGAAAAGACAAGCCACAGACTGG + Intergenic
905487607 1:38314908-38314930 TTAAAAGACAAGCCACAGACTGG - Intergenic
905558578 1:38907941-38907963 TAAAAAGACAAGCTACAGACTGG + Intronic
906321279 1:44818550-44818572 CTATTAGAAAAGCTCCATAGGGG + Intergenic
906672911 1:47670345-47670367 CAAAAAGGCAAGCTAAAGAGTGG - Intergenic
906731694 1:48087464-48087486 TGAAAAGACAAGCTACAGAATGG - Intergenic
907532817 1:55118621-55118643 CTAAAAGACAACCCACAGATTGG + Intronic
907605052 1:55807610-55807632 CTATAAGAAATGCTAAAGGGAGG + Intergenic
907733585 1:57090495-57090517 CTATAAGAAAAGCATCAGACAGG - Intronic
907966522 1:59335938-59335960 CGAAAAGACAAGCTACAGACTGG - Intronic
908749390 1:67405263-67405285 CTATAATACAAGGTACAGGTAGG + Intergenic
908871234 1:68615539-68615561 CTATAAGACAATCCCGAGAGAGG + Intergenic
908945439 1:69490711-69490733 TTAGAAGACAAGCCACAGAATGG + Intergenic
909728282 1:78862723-78862745 AGATAAGACAAGCCACAGATTGG - Intergenic
909854935 1:80516754-80516776 CTATCAGGCAACCTACAGATTGG - Intergenic
910111649 1:83689900-83689922 CTATAATACCACCTACAGGGTGG - Intergenic
910979113 1:92941051-92941073 TGAAAAGACAAGCTACAGACTGG - Intronic
913153063 1:116064909-116064931 ATATGAGACATGCTACAGAGAGG + Intronic
913193762 1:116435580-116435602 TGAAAAGACAAGCTACAGAATGG - Intergenic
913298115 1:117341901-117341923 ATATAAGATCACCTACAGAGGGG - Intergenic
915940422 1:160115279-160115301 CTATAATAGAAGGAACAGAGTGG + Intergenic
916468715 1:165100019-165100041 CAAAAAGACAACCTACAGAATGG + Intergenic
917913016 1:179670825-179670847 CTAAAAGGCAAGCCACAGACTGG - Intronic
918199226 1:182251625-182251647 CAAAAAGACAACCTACAGAATGG + Intergenic
921620312 1:217318958-217318980 TTAGAAGACAAGCCACAGACTGG + Intergenic
921749226 1:218773777-218773799 CCATAAGCCAAGCAACATAGTGG - Intergenic
922637015 1:227184131-227184153 TAAAAAGACAAGCTACAAAGTGG - Intronic
922861416 1:228819640-228819662 AAAAAAGACAAGCTACAGAGTGG - Intergenic
923181115 1:231520883-231520905 TTAAAAGGCAAGCTACAGATAGG + Intergenic
923345769 1:233050877-233050899 ATAAAAGACAACCTACAGAATGG + Intronic
923347924 1:233074629-233074651 CGAAAAGACAAGCTACAGACTGG + Intronic
923352241 1:233119806-233119828 GGAAAAAACAAGCTACAGAGTGG + Intronic
923891730 1:238223157-238223179 CTATAAGCCCAGCTATAGAAAGG - Intergenic
923954714 1:239003072-239003094 GTAAAACACCAGCTACAGAGTGG - Intergenic
924132201 1:240922425-240922447 CTGAAAGACAAACTACAGACTGG + Intronic
924234902 1:241992461-241992483 CACTAACACAACCTACAGAGGGG - Intergenic
924851031 1:247830643-247830665 CTATAACACAAGAAAAAGAGAGG - Intergenic
1063084873 10:2807164-2807186 TCAAAAGACAAACTACAGAGTGG + Intergenic
1063149915 10:3327129-3327151 TGAAAAGACAAGCTACAGATTGG - Intergenic
1063336559 10:5221094-5221116 CTATAAGAAATGCTAAAGTGAGG + Intergenic
1065170430 10:23021903-23021925 TAAAAAGACAAGGTACAGAGTGG - Intronic
1065529993 10:26659494-26659516 TTAGAAGACAAGCCACAGACTGG - Intergenic
1066077978 10:31899927-31899949 TGAAAAGACAAGCTACAGACTGG + Intronic
1066658201 10:37713680-37713702 TTATAAGAAATGATACAGAGAGG + Intergenic
1067042690 10:42963348-42963370 TTATAAGAAACGATACAGAGAGG + Intergenic
1067042793 10:42964309-42964331 TGAAAAGACAAGCTACAGACTGG - Intergenic
1067241863 10:44503831-44503853 TAAAAAGACAAGCTACAGATTGG + Intergenic
1067744091 10:48921626-48921648 TGAAAAGACAAGCTACAGACTGG + Intronic
1068193370 10:53683848-53683870 CTAGAAGAAAAGTTATAGAGAGG - Intergenic
1068649142 10:59502167-59502189 CTAACAGACAATCTACAGAATGG + Intergenic
1068832506 10:61512801-61512823 CTAAAAGATAAGCCACAGATGGG - Intergenic
1069154248 10:65005566-65005588 TGAGAAGACAAGCCACAGAGTGG - Intergenic
1069300795 10:66904571-66904593 CGAACAGACAAGCTACAGAATGG + Intronic
1070449706 10:76545861-76545883 TTTTAGGACAACCTACAGAGGGG - Intronic
1071241803 10:83715125-83715147 TTATAAATTAAGCTACAGAGTGG + Intergenic
1071418915 10:85469274-85469296 CTATCAAACAACCTACAGAATGG + Intergenic
1071443099 10:85720911-85720933 TGAAAAGACAAGCTATAGAGTGG + Intronic
1071714997 10:88086695-88086717 CTATTGCACAAGCTACAGAAAGG - Intergenic
1072507960 10:96089296-96089318 CTATAGGACACCCTGCAGAGAGG + Intergenic
1072509539 10:96105580-96105602 TTAAAAGACAAGCCACAGACTGG - Intergenic
1073187187 10:101622745-101622767 AAAAAAGACAAGCTACAGATTGG + Intronic
1074666957 10:115738260-115738282 CTATAACCCCAGCTACAGACTGG - Intronic
1074733964 10:116408519-116408541 TGAAAAGACAAGCTACAGACTGG - Intergenic
1074940192 10:118228635-118228657 ATAAAAGACAAGCTACAGAGTGG + Intergenic
1075592198 10:123700197-123700219 TGAAAAGACAAGCTACAGAATGG + Intergenic
1076351932 10:129822417-129822439 TGAAAAGACAAGCCACAGAGTGG - Intergenic
1076622318 10:131799046-131799068 CTAAAAGGCAAGCCACAGACTGG + Intergenic
1077449244 11:2625978-2626000 CAATAAGACAACCTACAGAATGG - Intronic
1078948979 11:16106797-16106819 CTAAAAGACAAATTACAGAATGG + Intronic
1079474578 11:20815591-20815613 GTAAAAGACAACCTACAGAATGG - Intronic
1079582121 11:22078723-22078745 TTATATGATAAGCTATAGAGGGG - Intergenic
1079914942 11:26357628-26357650 TGAAAAGACAAGCTACAGACTGG - Intronic
1080167514 11:29257016-29257038 TAATAAGACAACCTACAGAATGG - Intergenic
1080741903 11:35073557-35073579 TAAAAAGACAAGCTACAGACTGG + Intergenic
1080851957 11:36078077-36078099 CAACAGGACAAGCTGCAGAGAGG - Intronic
1081928691 11:46852423-46852445 GTAATAGACAAGCTACAGAATGG - Intergenic
1082210968 11:49500675-49500697 CTAGAAGACAAGCAACAAAATGG + Intergenic
1083126355 11:60570894-60570916 TGAAAAGACAATCTACAGAGTGG + Intergenic
1083368018 11:62153700-62153722 TTTAAAGACAAGCTACAGACTGG - Intergenic
1084885259 11:72200320-72200342 TTAAAAGACAAGCAACAGACTGG + Intergenic
1086763008 11:90657466-90657488 TCAAAAGACAAGCCACAGAGTGG - Intergenic
1086831054 11:91564287-91564309 GAAGTAGACAAGCTACAGAGTGG - Intergenic
1088088834 11:106013434-106013456 TTATAAAACAAGATCCAGAGAGG + Intronic
1088324136 11:108584954-108584976 AGTTAAGACAAGCTACAGATGGG + Intronic
1088527246 11:110770587-110770609 CAAAGAGACAACCTACAGAGTGG + Intergenic
1088571238 11:111225654-111225676 TTAAAAGACAACCTACAGAATGG + Intergenic
1088962825 11:114687050-114687072 CAAACAGACAAGCTACAGAATGG - Intronic
1089234800 11:117014527-117014549 GGAAAAGACAAGCTACAGAGGGG + Intronic
1089670060 11:120049891-120049913 TGAAAAGACAAGCTACAGAGTGG + Intergenic
1090863451 11:130674351-130674373 AAATAAGACAAGCTACACATTGG - Intronic
1091462689 12:657198-657220 GAATAAGACAAGCCACAGACTGG + Intronic
1092148800 12:6232904-6232926 CGATAAGACAGGCTCCAGAAAGG - Intronic
1092702014 12:11242498-11242520 CAAAAAGATAAGCTACAGACAGG + Intergenic
1092787821 12:12045034-12045056 TGAAAAGACAAGCTACAGAGTGG + Intergenic
1093109637 12:15134036-15134058 TCATAAGACAAGCCACAGACTGG - Intronic
1093719450 12:22422200-22422222 CCAAAAGACAACCTACAGAATGG + Intronic
1093719949 12:22428840-22428862 CCAAAAGACAACCTACAGAATGG + Intronic
1094374913 12:29779732-29779754 CAAAAAGACAAGCTACAGAGTGG + Intronic
1095121229 12:38422346-38422368 TTATCAGACAACCCACAGAGTGG + Intergenic
1095492890 12:42754172-42754194 TTAAAAGACAAGCCACAGAATGG + Intergenic
1097786170 12:63762241-63762263 GAATAAGACAAGCTACAGACTGG - Intergenic
1098121006 12:67238330-67238352 CTAAAAGACAAGATACGGAGTGG + Intergenic
1098406684 12:70133738-70133760 GTAAAAGACAATCTACAGAATGG - Intergenic
1098965084 12:76779249-76779271 GGAAAAGACAAGCTACAGACTGG - Intronic
1099232785 12:80047237-80047259 TGATAAGACAAACCACAGAGTGG + Intergenic
1100030530 12:90184328-90184350 TTAAAATACAAGCCACAGAGTGG + Intergenic
1100826699 12:98481495-98481517 CTATAAGCCCAGCTACTGAGGGG + Intergenic
1100854533 12:98747121-98747143 CGAAAAGACAACCTACAGAATGG + Intronic
1101089373 12:101269379-101269401 GAATAAGACAAGCCACAGACTGG - Intergenic
1101271693 12:103153382-103153404 TTAAAAGGCAACCTACAGAGTGG + Intronic
1101463295 12:104919764-104919786 TGAAAAGACAAGCTACAGAGTGG - Intronic
1101575771 12:105995112-105995134 CTAGAAGACAAGCTCCATGGGGG + Intergenic
1101756517 12:107625270-107625292 TGAAAAGACAAGCTACAGAGTGG - Intronic
1101790729 12:107924776-107924798 TGAAAAGAGAAGCTACAGAGTGG + Intergenic
1103608618 12:122107097-122107119 CTCTTAGTCAAGCTACAGAGTGG - Intronic
1103833839 12:123803012-123803034 AGAAAAGACAAGCGACAGAGTGG - Intronic
1104079016 12:125414275-125414297 CAAAAAGACAACCTACAGAATGG - Intronic
1105623858 13:22094267-22094289 CTATAAAACTAGCTACAGTATGG - Intergenic
1106108039 13:26751316-26751338 CCACAATACAGGCTACAGAGAGG - Intergenic
1107847387 13:44530573-44530595 CGAGAAGACAAGCCACAGATTGG + Intronic
1107918015 13:45172479-45172501 AAAAAAGACAACCTACAGAGTGG - Intronic
1109593424 13:64517937-64517959 TTAAGAGACAAGCTACAGACTGG - Intergenic
1111061726 13:83028930-83028952 CTAGAAAACAATCTACAGAATGG + Intergenic
1111381865 13:87465383-87465405 CTATATGACAAGTTAAAGATTGG + Intergenic
1111523748 13:89439940-89439962 TGGAAAGACAAGCTACAGAGTGG + Intergenic
1111937956 13:94576613-94576635 CAAGAAGACAAGACACAGAGAGG - Intronic
1113196587 13:107815209-107815231 CTAAAAGACAACCCAAAGAGTGG + Intronic
1114948699 14:27718926-27718948 CTATAAGGCAGGCGACAGAGAGG - Intergenic
1115790210 14:36869650-36869672 CTATAAGAACAGCTTCAGACTGG + Intronic
1115845591 14:37529781-37529803 CTATGAGAGGAGCTGCAGAGAGG + Intronic
1116202770 14:41820055-41820077 GTATCAGACAACCTACAGAATGG - Intronic
1116243288 14:42375399-42375421 TTATAAGACAAGCCACAGAGTGG - Intergenic
1116875639 14:50108312-50108334 TTATAAAACAAGCTAAAAAGTGG + Intergenic
1117017957 14:51537942-51537964 CAAAAAGACAAGCCACAGACTGG - Intronic
1117042321 14:51778430-51778452 ATATGGGACAAGATACAGAGGGG - Intergenic
1117505034 14:56393511-56393533 TGAGAAGACAAGCTACAGACTGG + Intergenic
1117743841 14:58847148-58847170 CTAGAAGACAAACCACAGAAAGG + Intergenic
1118534808 14:66749781-66749803 CGAAAAGACAAGCCACAGACTGG - Intronic
1119012052 14:71003483-71003505 CAAAAAGACAAGCCACAGAATGG - Intronic
1119063377 14:71500188-71500210 CAAAAAGGCAAGTTACAGAGTGG + Intronic
1119407759 14:74409465-74409487 CTGTGAGACAAGCTTCACAGAGG - Exonic
1119434042 14:74586340-74586362 CTATATGGCCAGCTGCAGAGTGG + Intronic
1120184386 14:81378559-81378581 TGAAAAGACAAGCTACAGACTGG - Intronic
1120452814 14:84691588-84691610 CAAAAAGACAAGCTACACATTGG - Intergenic
1120683556 14:87510879-87510901 ATAAAAGATAAGCTACAGATGGG - Intergenic
1120981391 14:90292399-90292421 CTGGAAGACAATCTCCAGAGGGG + Intronic
1121266505 14:92606169-92606191 CAAAAAGACAAACTACAGAATGG + Intronic
1121430787 14:93886453-93886475 AGAAAAGACAAGCTACAGATTGG - Intergenic
1121488191 14:94337103-94337125 ATTTAAGGCAAGCTACAGATAGG - Intergenic
1121732663 14:96197408-96197430 CTACAAGGCAAGCAGCAGAGCGG - Intergenic
1122403803 14:101484822-101484844 CGAAAAGACAAGTTACAGACAGG - Intergenic
1122710987 14:103658011-103658033 ATGGAAGCCAAGCTACAGAGGGG - Intronic
1124389059 15:29237282-29237304 TGAAAAGACAAGCTACAGACAGG - Intronic
1124508449 15:30300629-30300651 CAAAAAGCCAAGCTACAGAATGG - Intergenic
1124735108 15:32238031-32238053 CAAAAAGCCAAGCTACAGAATGG + Intergenic
1124842255 15:33253660-33253682 TGAAAAGACAAGCTACAGACTGG - Intergenic
1125003041 15:34791446-34791468 CTATAAGACACACTGCAGGGTGG + Intronic
1125240642 15:37570894-37570916 ATAAAAGACAAGCTACAGATTGG + Intergenic
1125305625 15:38309531-38309553 TGAAAAGACAAGCTACAGACTGG - Intronic
1125776400 15:42219338-42219360 TGAAAAGACAACCTACAGAGTGG - Intronic
1125845373 15:42847362-42847384 TGAAAAGACAAGTTACAGAGTGG - Intronic
1125873166 15:43120878-43120900 TTATAAAACAGGCTCCAGAGAGG - Intronic
1125955986 15:43791579-43791601 CAGTAAGAAAAGCTCCAGAGGGG + Intronic
1126381654 15:48054291-48054313 GAAGAAGACAAGCTACAGACAGG + Intergenic
1127404328 15:58625211-58625233 CGAAAAGACAAGCTACAGACTGG + Intronic
1127850283 15:62906062-62906084 CTATAAGAAAAGCTCCATAAAGG + Intergenic
1128496126 15:68199639-68199661 CTGTATGACAAGCAGCAGAGGGG - Exonic
1128621320 15:69152701-69152723 GAAGAAGAAAAGCTACAGAGAGG - Intergenic
1129581654 15:76818501-76818523 GAATAAGACAAGCCACAGACAGG + Intronic
1129854559 15:78813974-78813996 AAACAAGACCAGCTACAGAGAGG + Intronic
1131952721 15:97698396-97698418 TAAAAAGACAAGCTACAGACTGG - Intergenic
1132255899 15:100375123-100375145 TCAGAAGACAAGCTACAGACTGG - Intergenic
1134776362 16:16857108-16857130 TTATAAGACAAGACACAGAGTGG + Intergenic
1135433709 16:22410029-22410051 CGAGAAGACAAGCCACAGATGGG - Intronic
1137233665 16:46594297-46594319 TGAAAAGACAAGCTACAGAGTGG + Intronic
1137316951 16:47335431-47335453 TAAAAAGACAAGCTGCAGAGTGG + Intronic
1138145421 16:54604830-54604852 TTATAAGACATGATACAGATTGG + Intergenic
1138308238 16:55998633-55998655 TGAAAAGACAACCTACAGAGTGG - Intergenic
1138479871 16:57295374-57295396 ATAAAAGACAAGCCACAGACTGG - Intergenic
1138644727 16:58416244-58416266 TTAAAAGACAAGCTACAGAATGG - Intergenic
1138994270 16:62429582-62429604 ATAAAAGACAAGGTACAGACTGG + Intergenic
1139473966 16:67193244-67193266 CTATAAGACAAACTCCCAAGAGG - Intronic
1139621151 16:68144054-68144076 TGAAAAGACAAGCTACAGACAGG + Intronic
1139914642 16:70420503-70420525 CTACAAGACAACCTAGACAGTGG + Intronic
1140446463 16:75032603-75032625 TAATAAGACAAGTTACAGAATGG + Intronic
1141209735 16:81966302-81966324 CTGTACAACAAGCCACAGAGCGG + Intergenic
1142171555 16:88625179-88625201 CTGTAATACAAGCAACAGCGGGG - Intronic
1142922690 17:3204546-3204568 CTTTAAGACAACCGACAGAATGG - Intergenic
1144399170 17:14878163-14878185 TGATAAGACAAACTACAGAATGG + Intergenic
1145180514 17:20746457-20746479 CTCTGAGACAAACTATAGAGAGG - Intergenic
1148572259 17:48679363-48679385 CTAGAATACAAGCTTCAGAAGGG + Intergenic
1148832031 17:50440057-50440079 CTAAAAGACAAGCAACAGCCTGG - Intronic
1149124804 17:53215680-53215702 CTCAAAGGCAAGCTACAGAATGG - Intergenic
1149160387 17:53686750-53686772 CTGGATGACAAGCTGCAGAGAGG - Intergenic
1149437844 17:56649063-56649085 CCATAAAACAAACTACAAAGAGG + Intergenic
1149477734 17:56977298-56977320 CTAGGAGACAAGCTACAGCAGGG - Intergenic
1149840113 17:59955448-59955470 CTCTGAGACAAACTACAGAGAGG - Intronic
1150014558 17:61540578-61540600 CAAGAAGACAACCTACAGAATGG - Intergenic
1150089166 17:62305904-62305926 TTTTAAGACAACCCACAGAGTGG - Intergenic
1151624743 17:75269949-75269971 CTGGAAGACAAGCTACATTGAGG - Intronic
1151773123 17:76177813-76177835 CCATAAGACCAGCTGCAGAGAGG + Intronic
1153372031 18:4328974-4328996 TTAAAAGACCAGCTACAGACTGG - Intronic
1154250731 18:12742229-12742251 TAAAAAGACAAGCCACAGAGTGG - Intergenic
1154282766 18:13021005-13021027 GTAAAAGACAACCTACAGAATGG - Intronic
1155665379 18:28301461-28301483 GTATAAGACAAGCCACAGACTGG + Intergenic
1155985240 18:32223680-32223702 TAAAAAGATAAGCTACAGAGTGG - Intronic
1156256715 18:35404935-35404957 CTATATGTCAACCTACAGAATGG - Intergenic
1157400540 18:47383025-47383047 CCATAAGCCCAGCAACAGAGAGG + Intergenic
1157636243 18:49157700-49157722 CAAAAAGACAATCTACAGAATGG - Intronic
1158700995 18:59746386-59746408 TTAGAAGACAAGCCACAGACTGG - Intergenic
1158910300 18:62054416-62054438 TAAAAAGACAAGCTACAGACTGG + Intronic
1159490838 18:69132252-69132274 TTAAAATTCAAGCTACAGAGTGG - Intergenic
1159795646 18:72840012-72840034 CTATAAGACAAGCTACAGAGAGG - Intronic
1160052838 18:75452558-75452580 CAAAAAGACAAGCCACAGACTGG - Intergenic
1160069792 18:75617484-75617506 TCAAAAGACAAGCTACAGACAGG + Intergenic
1160223651 18:76995891-76995913 GAAAAAGACAAGCTACAGACAGG + Intronic
1160567249 18:79794496-79794518 CTAAAAGAGAAGCTACAGGAAGG + Intergenic
1162697686 19:12488924-12488946 TGAAAAGACAAGCTACAGAATGG - Intronic
1162698121 19:12493149-12493171 TGAAAAGACAAGCTACAGAATGG + Intronic
1162710646 19:12591438-12591460 TGAAAAGACAAGCTACAGACAGG + Intronic
1163192658 19:15689153-15689175 TTAACAGACAACCTACAGAGTGG + Intronic
1168178214 19:54641192-54641214 CGAACAGACAAGCTACAGAATGG - Intronic
1168635652 19:57994513-57994535 AGTTAAGACAAGCTACAGACTGG + Intronic
925795298 2:7534929-7534951 TTAAAAGACAACATACAGAGTGG - Intergenic
926541292 2:14183411-14183433 TCAGAAGACCAGCTACAGAGAGG + Intergenic
926691547 2:15737965-15737987 CTAAAAGACAGTCTCCAGAGTGG - Intronic
927024686 2:19054212-19054234 TTAAAAGACAACCCACAGAGTGG - Intergenic
927795949 2:26048923-26048945 TGAAAAGACAAGCTACAGACTGG - Intronic
927876985 2:26664199-26664221 ATGAAAGACAAGCCACAGAGTGG - Intergenic
928395492 2:30940575-30940597 CTATAAGAAATGCTGTAGAGAGG + Intronic
928444445 2:31320498-31320520 CTATAATCCCAGCTACAGGGAGG + Intergenic
928809096 2:35199759-35199781 CGAAAGGACAAGCCACAGAGTGG - Intergenic
928862973 2:35882275-35882297 CTCTAAAACAAGATACAAAGTGG + Intergenic
928886666 2:36157013-36157035 TTAAAAGACAAGCTACAGATTGG + Intergenic
928991697 2:37238722-37238744 TGATTAGACAAGCCACAGAGTGG + Intronic
929232126 2:39570611-39570633 CTATAGGACTAGCTAAAGGGTGG + Intergenic
931107696 2:59074757-59074779 CTGTAAAACAAGCTTCAGAAGGG - Intergenic
931322700 2:61187061-61187083 CTATAGGACAAGCTTCAGCTTGG - Exonic
931571593 2:63674383-63674405 GAAAAAGAAAAGCTACAGAGGGG + Intronic
931637484 2:64353787-64353809 CTATAAGAAATGCTAAAGAGAGG + Intergenic
933479424 2:82836771-82836793 TGAAAAGACAAGCTACAGAATGG - Intergenic
933764180 2:85695770-85695792 CTCTAAGACAAGCAAAAGGGTGG + Intronic
933861508 2:86474238-86474260 CCAAAAGACAAGCTAGACAGGGG - Intronic
934535800 2:95132184-95132206 TTAAATGACAAGCTACAGACTGG + Intronic
934916039 2:98301798-98301820 TTAAAAGACAAGCAACAGACCGG - Intronic
935177100 2:100658554-100658576 CAAAAAGACAAGCTACAGATTGG - Intergenic
935805152 2:106738570-106738592 TTAAAAGACAATCTACAGAATGG - Intergenic
935825862 2:106948577-106948599 CTATAATAAAAGCTTCAGAAAGG + Intergenic
935933517 2:108155698-108155720 CTATGAGACAAGATGCAGTGTGG + Intergenic
935938576 2:108214308-108214330 CTATAAGAAAGGCTCCAAAGGGG + Intergenic
936408308 2:112228790-112228812 AAATAAGACAAGCCACAGATTGG + Intronic
936695700 2:114945291-114945313 CGACTAGACAAGCTACAGACTGG + Intronic
937403144 2:121603007-121603029 TAAAAAGACAAGCTACAGAATGG + Intronic
938209299 2:129453409-129453431 TGAAAAGACAAGCTACAGAGTGG + Intergenic
938220622 2:129563614-129563636 CAAAAACACAAGCCACAGAGTGG - Intergenic
938600359 2:132831653-132831675 TTAAAAGACAAGAAACAGAGAGG - Intronic
939087321 2:137737125-137737147 CAAAAAGACAACCTACAGAATGG + Intergenic
939173915 2:138727701-138727723 GGAGAAGACAAGCTACAGACTGG - Intronic
939212048 2:139188200-139188222 ATAAAAGACAACCTACAGAATGG - Intergenic
940515617 2:154680762-154680784 GTATAGTACAAACTACAGAGGGG + Intergenic
942253236 2:174065513-174065535 TGAGAAGACAAGCTACAGACTGG - Intergenic
942747349 2:179250075-179250097 TGAAAAGACAAGCTACAGAGTGG + Intronic
942885658 2:180920247-180920269 TGAAAAGACAAGCTATAGAGTGG + Intergenic
942916160 2:181309842-181309864 AGAGAAGACAAGCTACAGAGAGG + Intergenic
942937541 2:181575930-181575952 CTCTGAGACAAACTTCAGAGAGG - Intronic
943468004 2:188254315-188254337 TGAAAAGACAAGCTACAGAACGG + Intergenic
945770373 2:214035137-214035159 TGATAAGACCAGCTGCAGAGAGG - Intronic
947069897 2:226277125-226277147 TCAAAAGACATGCTACAGAGTGG + Intergenic
948161957 2:235832245-235832267 CGAGAAGACAAGCTACAGACTGG - Intronic
948235119 2:236381914-236381936 TAAAAAGACAAGCTACAGACTGG - Intronic
1169604184 20:7296926-7296948 CAAATAGACAACCTACAGAGTGG - Intergenic
1170071855 20:12377880-12377902 ATAAAAGACAAGATACACAGAGG + Intergenic
1170092195 20:12602864-12602886 ATTTAAGACAAGATACATAGGGG + Intergenic
1170865928 20:20157823-20157845 TGAAAAGACAAGCTACAGACTGG + Intronic
1170927535 20:20739372-20739394 TTAACAGACAACCTACAGAGTGG + Intergenic
1171018886 20:21566164-21566186 CGAGAAGGCAAGCCACAGAGTGG - Intergenic
1172016422 20:31877147-31877169 TTAAAAGATAAGCTACAGACTGG - Intronic
1173335058 20:42105947-42105969 TGATAAGCCAAGGTACAGAGTGG + Intronic
1173341714 20:42158252-42158274 CTAGAATACAAGCTTCAGAAGGG + Intronic
1173772317 20:45671946-45671968 GTAAAAGACAACCTACAGAATGG + Intergenic
1173909408 20:46653190-46653212 TGAAAAGACAAGCTACAGACGGG - Intronic
1174196896 20:48779060-48779082 ACAAAAGACAAGCTACAGATGGG + Intronic
1174520425 20:51125912-51125934 CTTTGAGACAGGCTTCAGAGGGG - Intergenic
1175163796 20:57028962-57028984 CCATAAGAGAAGCTGCAGAGGGG + Intergenic
1175380951 20:58563683-58563705 CCAAAAGACAAGACACAGAGTGG + Intergenic
1177028227 21:15949607-15949629 CGAAAAGACAAGCTACAGTTGGG - Intergenic
1177287342 21:19069268-19069290 GTAAAAGACAACCCACAGAGTGG + Intergenic
1178685400 21:34706728-34706750 CTATTATACAAGCAACAGTGTGG - Intronic
1179247154 21:39643867-39643889 CTACAAAATAAGCCACAGAGGGG - Intronic
1180542889 22:16468424-16468446 TAAAAAGACAACCTACAGAGTGG + Intergenic
1180543066 22:16470610-16470632 TAAAAAGACAACCTACAGAGTGG + Intergenic
1182140971 22:27958028-27958050 TGAAAAGACAACCTACAGAGTGG + Intergenic
1182378338 22:29865491-29865513 AAAAAAGACAAGCTACAGACTGG - Intergenic
1183001935 22:34867620-34867642 TGAAAAGACAAGCTACAGACTGG + Intergenic
1183491443 22:38118617-38118639 TAAAAAGACAAGCCACAGAGTGG - Intronic
1183491623 22:38119959-38119981 CAGAAAGACAAGCCACAGAGTGG + Intronic
949653270 3:6186150-6186172 CTAAAAGATAAGCTACAGGCTGG - Intergenic
949703943 3:6793896-6793918 CAAGGAGACAACCTACAGAGTGG - Intronic
952022029 3:29034465-29034487 TGAATAGACAAGCTACAGAGTGG - Intergenic
952473296 3:33679439-33679461 TGAGAAGACAAGCCACAGAGTGG + Intronic
952804893 3:37339813-37339835 TAAAAAGACAAGCTACAGAATGG - Intronic
953162162 3:40431137-40431159 TGAAAAGACAAGCCACAGAGTGG + Intergenic
953587711 3:44219971-44219993 TGAAAAGACAAGCTACAGAATGG - Intergenic
955185842 3:56714379-56714401 TGAAAAGACAAGCCACAGAGTGG - Intergenic
956803676 3:72787636-72787658 GTATAAAACAGGCTACAGAATGG + Intronic
957400403 3:79705118-79705140 CGAGTAGACAAGCCACAGAGTGG - Intronic
958596526 3:96232423-96232445 CTATAACAAATACTACAGAGTGG + Intergenic
958617735 3:96516652-96516674 CTACAAGAAATGCTAAAGAGAGG + Intergenic
959752211 3:109851345-109851367 TTATAAGAAATGCTAAAGAGAGG + Intergenic
960333882 3:116392840-116392862 CGGGATGACAAGCTACAGAGAGG + Intronic
961026023 3:123558284-123558306 TTTTAAGACAAGCCCCAGAGTGG + Intronic
961516238 3:127439119-127439141 TAAGAAGACAAGCTACTGAGGGG + Intergenic
961574916 3:127826726-127826748 TTAAAAGACAAGCTACAGACTGG - Intergenic
962711724 3:138092117-138092139 CTGTAAGATAGGCTACTGAGAGG - Intronic
963891934 3:150645453-150645475 CAAAAAGGCAAGCTACAGAATGG + Intergenic
964942797 3:162181180-162181202 ATAAAGGACAAGCTACAGACAGG + Intergenic
966270170 3:178095472-178095494 GTAAAAGACAACCTAAAGAGTGG + Intergenic
966701344 3:182855581-182855603 TGAAAAGACAAGCTACAGACTGG + Intronic
967040170 3:185684705-185684727 CTATAAGAAATGCTACAGTGAGG - Intronic
967208275 3:187144032-187144054 TGAAAAGACAAGCTACAGAATGG - Intronic
967363717 3:188661719-188661741 TGAGAAGACAAGCCACAGAGTGG - Intronic
968018265 3:195359166-195359188 CTACAAGAAATGCTACAGGGAGG + Intronic
968560481 4:1278646-1278668 CAAAAAGACAACCTACAGAATGG - Intergenic
969078596 4:4600701-4600723 CTTTGAGACAGGCTACAGTGTGG - Intergenic
969216365 4:5725657-5725679 GTGTAAGACAATCTACAGAAGGG - Intronic
969962941 4:10964538-10964560 CTCTAAGAATAACTACAGAGAGG - Intergenic
969975368 4:11095184-11095206 GAATAAGACAAGCCACAGACTGG + Intergenic
970982911 4:22123041-22123063 CTAAAAGAAAAGCTACTCAGGGG + Intergenic
971221208 4:24707962-24707984 GTAAAAGACAAGCTACTGACTGG - Intergenic
971542099 4:27832054-27832076 CTATAAGAGATGATACAGAAAGG + Intergenic
971906707 4:32735678-32735700 CTAGAAGCCAAGCTAGAGTGTGG - Intergenic
972019879 4:34299286-34299308 CTGTAGGACAAGCTACCGATAGG + Intergenic
972072201 4:35036273-35036295 CAAAAAGGCAAGCTACAGAATGG + Intergenic
972531263 4:39963334-39963356 CTATAATACCAGCTACTCAGGGG + Intronic
974558195 4:63479611-63479633 TGAAAAGACAAGCTACAGATTGG + Intergenic
974610908 4:64214266-64214288 CTATAAGATAAACTACAGGCCGG - Intergenic
974899260 4:67977060-67977082 CTAACAGACAACCTACAGAATGG - Intergenic
974972983 4:68853963-68853985 CAATATGACCAGCTGCAGAGAGG - Intergenic
975894335 4:79069259-79069281 TTAAGAGACAAGCTACAGAATGG + Intergenic
976019050 4:80597480-80597502 CAAAAAGGTAAGCTACAGAGAGG - Intronic
976208124 4:82641130-82641152 CTATAATTCCAGCTACAGGGAGG + Intronic
976487010 4:85618911-85618933 CAACAAGACAATCTACAGAATGG - Intronic
976588553 4:86826033-86826055 CTGTAAGCCAATCTGCAGAGAGG + Intronic
977912667 4:102556088-102556110 ATAAAAGACAAGAGACAGAGAGG + Intronic
979071291 4:116210480-116210502 TAAAAAGACAAGCTACAGACTGG + Intergenic
979306046 4:119144880-119144902 TGAAAAGACAAGCTACAGAATGG - Intronic
979584453 4:122398909-122398931 TAATCAGACAAGCCACAGAGTGG - Intronic
979652552 4:123152317-123152339 TTAGAAGACAAGCTACAGGCTGG + Intronic
980002545 4:127507468-127507490 CTTAAAGACAAGCCACAAAGTGG + Intergenic
980607280 4:135109564-135109586 CCATCAGGCAACCTACAGAGTGG - Intergenic
980644700 4:135628326-135628348 CTAACAGACAACCCACAGAGTGG - Intergenic
981090956 4:140731592-140731614 CTATAAGACACGCAACAGCTTGG - Intronic
981102539 4:140845544-140845566 TAAAAAGACAAGCTACAGAATGG - Intergenic
982194066 4:152891828-152891850 CTGTAATTCCAGCTACAGAGAGG - Intronic
983119407 4:163862262-163862284 TTAAAAGACAAGCCACAGACTGG + Intronic
983246273 4:165291267-165291289 TTAAAAGACAAGCCACAGACTGG - Intronic
983749091 4:171241888-171241910 TGAAAAGACAAGCTACAGACTGG + Intergenic
984030384 4:174597073-174597095 TTATAAGAGAAGATTCAGAGAGG - Intergenic
984057281 4:174945431-174945453 TTTTAAGACAACCTACAGAAGGG - Intronic
985073111 4:186187831-186187853 TGATAAGGCAAACTACAGAGAGG + Intergenic
986703884 5:10439493-10439515 CAAAAAGACAAGCTGTAGAGTGG + Exonic
988047915 5:25982278-25982300 CTAAAAAATAAGCTACAGATTGG - Intergenic
988291349 5:29292021-29292043 TGAAAAGACAAGCTACAGAATGG + Intergenic
989582668 5:43047516-43047538 CTATAATCCCAGCTACACAGAGG + Intergenic
991112049 5:62911607-62911629 CAAAAAGACAACCTACAGAATGG - Intergenic
991147899 5:63328733-63328755 GTAAAAGACAACCTACAGAATGG - Intergenic
991548710 5:67812721-67812743 TTAACAGACAACCTACAGAGTGG + Intergenic
991594507 5:68288801-68288823 CTCCAAGACAAACTACAGAAAGG - Intronic
991647151 5:68811941-68811963 AGATAAGACAAGCCACAGACTGG - Intergenic
991734674 5:69620864-69620886 CTATAAGAAATGCTGAAGAGAGG - Intergenic
991780304 5:70125857-70125879 CTATAAGAAATGCTGAAGAGAGG + Intergenic
991811108 5:70476005-70476027 CTATAAGAAATGCTGAAGAGAGG - Intergenic
991859591 5:71001271-71001293 CTATAAGAAATGCTGAAGAGAGG + Intronic
991872751 5:71126168-71126190 CTATAAGAAATGCTGAAGAGAGG + Intergenic
993161383 5:84296785-84296807 TGATCAGACAAGCTACAGAATGG + Intronic
993381029 5:87207985-87208007 TAAAAAGACAACCTACAGAGTGG - Intergenic
993393432 5:87352149-87352171 ATTTAACACAAGCCACAGAGGGG - Intronic
994129205 5:96205187-96205209 TGAAAAGACAAGCTACAGACTGG - Intergenic
994677499 5:102843562-102843584 TGTAAAGACAAGCTACAGAGTGG + Intronic
994843487 5:104955148-104955170 ATATAATAAAAGCTACAGAAAGG + Intergenic
994867740 5:105299079-105299101 TCAAAAGACAAGCTACAGACTGG + Intergenic
995144960 5:108777231-108777253 GAATAAGACCAGCTACAGATTGG - Intronic
996360772 5:122643297-122643319 TGAGAAGACAAGCCACAGAGTGG + Intergenic
996456440 5:123688857-123688879 TAAAAAGACAAGTTACAGAGTGG + Intergenic
996579973 5:125020847-125020869 TGAAAAGACAAGCTACAGACAGG + Intergenic
997123882 5:131205919-131205941 CTAAAAGACAAGCCACATATTGG - Intergenic
997190960 5:131935081-131935103 AAAAAAGACAAGCTACAGATAGG + Intronic
997857615 5:137386862-137386884 TTAAAAGACAAGCCACAGACTGG + Intronic
998485582 5:142499067-142499089 CTTTAAGAAAAGAGACAGAGAGG - Intergenic
998540518 5:142977215-142977237 ATACAAGACAAGTTTCAGAGGGG + Intronic
999041417 5:148417406-148417428 CTATAAGAATACCTACAGAATGG + Intronic
1000012882 5:157249232-157249254 CTATAAGCATAGCTTCAGAGAGG + Intronic
1000819228 5:165962887-165962909 GTAAAAAACAAGCTACAGATTGG - Intergenic
1001754146 5:174154234-174154256 TTAAAAGACAAGCCACAGATTGG - Intronic
1001896273 5:175384583-175384605 TGAAAAGACAAGCTACAGACTGG + Intergenic
1001900775 5:175427251-175427273 TTAAAAGACAAGCCACAGACTGG + Intergenic
1003170176 6:3715105-3715127 GTATGAGACAAGCTCCAAAGTGG - Intergenic
1003263277 6:4544086-4544108 TGAAAAGACAAGCTACAGACTGG + Intergenic
1003992993 6:11506076-11506098 CAAACAGACAACCTACAGAGTGG + Intergenic
1004284024 6:14303784-14303806 TGAAAAGACAAGCTACAGACTGG - Intergenic
1004801047 6:19148436-19148458 TGGTAAGGCAAGCTACAGAGAGG - Intergenic
1004906655 6:20242891-20242913 TAAAAAGACAAGCTACAGAGTGG + Intergenic
1005129185 6:22485129-22485151 TTAAAAGACAAGCCACAGACTGG + Intergenic
1005523356 6:26620778-26620800 GTAAAAGACAACCTACAGAATGG - Intergenic
1005698323 6:28372657-28372679 TGAAAAGACAAGCTACAGATAGG - Intergenic
1006431169 6:33997157-33997179 CAAAAAGACAAGCCACAGAGTGG + Intergenic
1007117446 6:39353511-39353533 TTAAAAGACAAGCTACAGACTGG - Intronic
1007151354 6:39695361-39695383 CAAACAGACAACCTACAGAGTGG + Intronic
1008030010 6:46685222-46685244 GAAAAAGACAAGCTACAGACAGG - Intergenic
1008111713 6:47502184-47502206 CTGTAAGCCAACCTATAGAGAGG - Intronic
1008212662 6:48743812-48743834 AAAAAAGACAAGCTACAGACTGG + Intergenic
1008240797 6:49108807-49108829 CTCTACAACTAGCTACAGAGTGG + Intergenic
1008639937 6:53451657-53451679 CGAAAAGACAAGCCACAGACTGG - Intergenic
1009692354 6:67052172-67052194 TTAAAAGACAACCTACAGAATGG - Intergenic
1011048279 6:83111807-83111829 TTAGAAGACAATCTACAGAATGG - Intronic
1011706978 6:90011018-90011040 TCAAAAGACAAGCTACAGACTGG - Intronic
1012231141 6:96762449-96762471 CCAGATGACAAGCTGCAGAGAGG - Intergenic
1013897783 6:115112137-115112159 TCAAAAGACAAGCTACAGAGTGG + Intergenic
1014029732 6:116686487-116686509 GTAAAAGACAACCTACAGAATGG - Intronic
1014312938 6:119828304-119828326 CAAAAAGACAACCCACAGAGTGG - Intergenic
1015086213 6:129294714-129294736 CTGCAAGACAACCTACAGTGTGG - Intronic
1015092290 6:129373073-129373095 GAACAAGACAAGCCACAGAGGGG - Intronic
1015855584 6:137621289-137621311 CAAAAAGACAAGCTACAGTGAGG + Intergenic
1016405835 6:143729280-143729302 TGAAAAGACAATCTACAGAGTGG - Intronic
1016601706 6:145869282-145869304 TGAAAAGACAAGCTACAGAATGG - Intronic
1018408495 6:163514948-163514970 TTAAAAGACAAGCCACAGAGTGG + Intronic
1018674960 6:166212517-166212539 CAAAAAAACAACCTACAGAGTGG + Intergenic
1018717936 6:166548887-166548909 TGAAAAGACAAGCTATAGAGTGG + Intronic
1018836668 6:167489649-167489671 TGAAAAGACAAGCTACAGACTGG - Intergenic
1019090030 6:169521376-169521398 CTATAAGAAATGCTAAAGAAAGG + Intronic
1019566434 7:1682044-1682066 ATGAAAGACAAGCTCCAGAGTGG - Intergenic
1019753960 7:2754417-2754439 TGAAAAGACAAGCTACAGACTGG - Intronic
1022361761 7:29666755-29666777 TGAAAAGGCAAGCTACAGAGTGG - Intergenic
1022865509 7:34414743-34414765 TGAAAAGACAAGCTACAGGGTGG - Intergenic
1023106922 7:36771676-36771698 CAATAAGCCAACATACAGAGTGG + Intergenic
1023976634 7:45035152-45035174 CTCTAAGACGAACCACAGAGGGG - Intronic
1025986372 7:66456182-66456204 TGAAAAGACAAGCTACAGAATGG + Intergenic
1026028556 7:66768481-66768503 CAAAAAGACAAGCTACAGAATGG - Intronic
1026071619 7:67126415-67126437 TGAAAAGACAAGCTACAGACTGG - Intronic
1026297279 7:69064216-69064238 TAAAAAGACAAGCTACAGACTGG + Intergenic
1026705276 7:72685848-72685870 TGAAAAGACAAGCTACAGACTGG + Intronic
1028128058 7:87137329-87137351 TAAAAAGACAAGCTACAGAATGG + Intergenic
1028817121 7:95158644-95158666 TAAAAAGACAAGCTACAGATAGG + Intronic
1028928745 7:96389495-96389517 CTAAAAGATAAGATACAGGGAGG - Intergenic
1029834353 7:103293816-103293838 TGAAAAGACAAGCTACAGACTGG - Intergenic
1029908283 7:104116218-104116240 TTAAAAGACAAGCCACAGACTGG - Intergenic
1030096077 7:105901089-105901111 TGAGAAGACAAGCTACAGACTGG - Intronic
1030174791 7:106641190-106641212 CAAAAAGACAAGCTACAGACTGG + Intergenic
1030207004 7:106960817-106960839 CTAGAACACAAGCTCCAGAGTGG + Intergenic
1030553772 7:110997797-110997819 TAATAAGACAAGCTGCAGACTGG - Intronic
1031778671 7:125934985-125935007 CTATAAGACAAATTACAAACAGG + Intergenic
1031836486 7:126686043-126686065 CCAGATGACAAGCTGCAGAGAGG + Intronic
1032307430 7:130749410-130749432 TTAGAAGACAAGCAACAGACTGG + Intergenic
1032887661 7:136159079-136159101 AAAAAAAACAAGCTACAGAGTGG - Intergenic
1032892259 7:136209968-136209990 TGAAAAGACAACCTACAGAGTGG + Intergenic
1033291938 7:140092864-140092886 CTTTATGACCAGCTACAGTGAGG + Intronic
1033611110 7:142963917-142963939 ATAAAAGACAAGAAACAGAGTGG + Intergenic
1035069748 7:156134336-156134358 CTAAAAGATAAGCTACAGACAGG - Intergenic
1035382893 7:158451283-158451305 TTAAAAGACAAGCCACAGAATGG - Intronic
1035696043 8:1596813-1596835 CTATCAGGCAACCTACAGAATGG - Intronic
1036689199 8:10931898-10931920 TGAAAAGACAAGCTACAGATTGG + Intronic
1037012344 8:13859212-13859234 CTAGAAGAGAAGCCCCAGAGAGG + Intergenic
1037369576 8:18161502-18161524 CAAAAAGACAAGCTACAGAGTGG + Intergenic
1037875683 8:22546568-22546590 CTATTGGAGAAGCTGCAGAGGGG - Intronic
1038079671 8:24119775-24119797 CTATAATTCAAGCTACCAAGTGG + Intergenic
1038274756 8:26111863-26111885 CAAAAAGACAACCTACAGAATGG + Intergenic
1039004699 8:33021325-33021347 TTAAAAGACAAAGTACAGAGTGG - Intergenic
1039526683 8:38222942-38222964 TGAAAAGACAAGCTACAGACTGG - Intergenic
1039698487 8:39938642-39938664 CAAAAAGACAAGCCACAGACTGG + Intronic
1040857816 8:51968616-51968638 TGAAAAGACAAGCTTCAGAGTGG + Intergenic
1041020578 8:53634142-53634164 TTCTAAGACATGATACAGAGAGG + Intergenic
1041502128 8:58550605-58550627 TGAGAAGACAAGCTACAGACTGG - Intergenic
1042764358 8:72304031-72304053 TAAGAAGACAACCTACAGAGTGG - Intergenic
1042774092 8:72410380-72410402 TTATCAGACAACCTACAGAATGG + Intergenic
1042917197 8:73887217-73887239 TTAAAAGACAACCTACAGAATGG + Intergenic
1043047882 8:75351078-75351100 CAAACAGACAAGCCACAGAGTGG + Intergenic
1043358691 8:79443700-79443722 TAAAAAGACAAGCTACAGAATGG - Intergenic
1043562375 8:81509002-81509024 CAAGAAGACAAGCCACAGACTGG + Intergenic
1043966693 8:86485480-86485502 CTATAATACAAGGTAGAAAGTGG + Intronic
1044180235 8:89183740-89183762 CCAAAAGAAAATCTACAGAGAGG - Intergenic
1044193588 8:89348586-89348608 CTATCAGGCAACCTACAGAATGG - Intergenic
1045058096 8:98386648-98386670 CTATAAAACAAGGTACATTGAGG - Intergenic
1045130912 8:99151313-99151335 TTAAAAGACAAGCCACAGATTGG - Intronic
1045698583 8:104839442-104839464 CTGTAATCCCAGCTACAGAGTGG - Intronic
1047088838 8:121551140-121551162 TTAAAAGACAAGGTACAGACGGG - Intergenic
1047627863 8:126675280-126675302 TTAAAAGACAAGCCACAGATTGG + Intergenic
1048476678 8:134749079-134749101 TTAAAATACAAGCCACAGAGTGG - Intergenic
1050734120 9:8743841-8743863 TTAACAGACAACCTACAGAGTGG + Intronic
1050804344 9:9655158-9655180 GAATAAGACAAGCCACAGGGTGG + Intronic
1051019395 9:12523516-12523538 TAAAAAGACAAGCTGCAGAGTGG + Intergenic
1051071837 9:13178766-13178788 CTAAAAGACAAGTGACAGACTGG - Intronic
1051442440 9:17100196-17100218 TGAAAAGACAAGCTACAGACTGG - Intergenic
1051465610 9:17374168-17374190 CAAAGAGACAAGCCACAGAGTGG + Intronic
1053150390 9:35739473-35739495 CTAGAGGACAAGCTACAGAGGGG - Intronic
1054729645 9:68687998-68688020 TGAAAAGACAAGCTACAGACTGG + Intergenic
1055636065 9:78280667-78280689 ATAATAGACAAGCTACAGTGCGG + Intergenic
1055879655 9:80985013-80985035 TGAGAAGACAAGCTACAGACTGG - Intergenic
1056286844 9:85095797-85095819 GGAAAAGACAAGCCACAGAGTGG - Intergenic
1056855000 9:90119447-90119469 AAAAAAGGCAAGCTACAGAGTGG - Intergenic
1057088256 9:92231024-92231046 ATGAAAGACAAGCTACAGACTGG - Intronic
1057135524 9:92684958-92684980 TGAAAAGACAAGCTACAGACTGG + Intergenic
1057223951 9:93276628-93276650 TGAAAAGACAAGCTACAGACTGG + Intronic
1057296767 9:93850035-93850057 TGAAAAGACAAGCTACAGATTGG - Intergenic
1058387658 9:104457770-104457792 CTAACAGATAAGCTAAAGAGTGG + Intergenic
1059329960 9:113528678-113528700 CTATAGGAAAACATACAGAGAGG + Intronic
1059726388 9:117012557-117012579 CTTTAATACAACCTACAGTGTGG + Intronic
1060088086 9:120719505-120719527 CTAACAGACAAGCCACAGAAAGG + Intergenic
1185612400 X:1400658-1400680 CTATAATCCCAGCTACAGGGGGG - Intergenic
1186190090 X:7059782-7059804 TTTTGAGAGAAGCTACAGAGGGG + Intronic
1186910128 X:14154597-14154619 CAAAAAGACAACCTACAGAATGG - Intergenic
1187402275 X:18971918-18971940 CTAAAAGATGAGCTACAGAATGG - Intronic
1187465430 X:19522393-19522415 TGAGAAGACAAGCTACAGACTGG - Intergenic
1187798260 X:23028885-23028907 CGAGAAGACAAGCCACAGACTGG - Intergenic
1187989758 X:24856930-24856952 TGAAAAGACAAGCTACAGACTGG - Intronic
1188612984 X:32122112-32122134 CTATAGGCCAAGCTGCAGAAGGG + Intronic
1188932800 X:36134776-36134798 AGAAAAGACAAGCTACAGACTGG + Intronic
1189096395 X:38144713-38144735 CTGTAAGAAAAGCGACAAAGAGG - Intronic
1189933737 X:46042445-46042467 CATAAAGACAAGCCACAGAGTGG - Intergenic
1189996156 X:46640594-46640616 TTAAAAGACAAGCTACACACTGG + Intronic
1190008902 X:46766051-46766073 TGAAAAGACAAGCTACAGAGTGG + Intergenic
1190073373 X:47297291-47297313 TGAAAAGACAAGCTACAGACTGG - Intergenic
1191888176 X:65911010-65911032 CGATAAAACAATCTACAGAATGG - Intergenic
1191958122 X:66668518-66668540 AGATAAGACAATCTACATAGTGG + Intergenic
1192862018 X:75084683-75084705 TTAAAAAACAAGCTACAGACTGG + Intronic
1192912098 X:75615974-75615996 CAGTAAAACAAGCTACAGACTGG + Intergenic
1193781153 X:85702795-85702817 CAAAAAGACAACCTACAGAATGG + Intergenic
1193794593 X:85857917-85857939 CTATAAAACAAGGTACAAAGAGG + Intergenic
1193889865 X:87032154-87032176 TTAACAGACAACCTACAGAGTGG - Intergenic
1193940681 X:87677920-87677942 TAAAAAGACAAGCTACAGAATGG + Intergenic
1193972683 X:88075695-88075717 AGAAAAGACAAGCTACAGACTGG + Intergenic
1194027107 X:88765727-88765749 CTATAAAACAAGTTACAAAATGG + Intergenic
1194634180 X:96323381-96323403 TTATCAGACAACCCACAGAGTGG + Intergenic
1194998713 X:100620956-100620978 CAAAAAGACAAGCAACAGACTGG + Intergenic
1195119583 X:101736801-101736823 CTAGGAAACAAGCTACACAGAGG + Intergenic
1195135290 X:101900238-101900260 CAAACAGACAACCTACAGAGTGG - Intronic
1195237463 X:102915673-102915695 TTAACAGACAACCTACAGAGTGG + Intergenic
1195588376 X:106593617-106593639 TTAAAAGACAAGTCACAGAGTGG - Intergenic
1195635618 X:107112090-107112112 TGAAAAGACAAGCTACAGACTGG + Intronic
1195794397 X:108628687-108628709 CTATAAGACAAACAACTGACTGG - Intronic
1195832933 X:109079913-109079935 TGAAAAGACAAGCTACAGATTGG - Intergenic
1196202835 X:112905587-112905609 TCATAAGACAAGCCACAGAGTGG + Intergenic
1196527497 X:116743529-116743551 CAAACAGACAAACTACAGAGTGG - Intergenic
1196601649 X:117607412-117607434 CAAGAAGTCAAGTTACAGAGAGG + Intergenic
1196744757 X:119061169-119061191 TGAAAAGACAACCTACAGAGTGG + Intergenic
1197341392 X:125270540-125270562 TGAAAAGACAAGCTACAGATGGG - Intergenic
1197378435 X:125710048-125710070 CAAGATGACCAGCTACAGAGAGG + Intergenic
1197397571 X:125945830-125945852 CTACAAGAGAAGGTACAGTGTGG - Intergenic
1198454531 X:136803298-136803320 TGAAAAGACAAGCTACAGACTGG - Intergenic
1198516314 X:137411436-137411458 AAAAAAGACAAGCTACATAGTGG - Intergenic
1198817350 X:140606546-140606568 GACAAAGACAAGCTACAGAGTGG - Intergenic
1199688641 X:150288819-150288841 TGAAAAGACAAGCTACAGACTGG + Intergenic
1199738358 X:150707288-150707310 TGAAAAGACAAGCTACAAAGTGG + Intronic
1199750496 X:150812259-150812281 TAAAAAGACAAGCTACAGAATGG + Intronic
1200278437 X:154756351-154756373 TAAAAAGACAAGCTACAGACTGG + Intergenic
1200362162 X:155618981-155619003 TGAAAAGACAAGCAACAGAGTGG - Intronic