ID: 1159797831

View in Genome Browser
Species Human (GRCh38)
Location 18:72866718-72866740
Sequence TGGTAACGCGGGCAGTGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 46}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159797831_1159797844 24 Left 1159797831 18:72866718-72866740 CCTCTACACTGCCCGCGTTACCA 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1159797844 18:72866765-72866787 GTCTCCAGGGCGGAAAGGGGTGG 0: 1
1: 0
2: 7
3: 52
4: 352
1159797831_1159797840 14 Left 1159797831 18:72866718-72866740 CCTCTACACTGCCCGCGTTACCA 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1159797840 18:72866755-72866777 GACATCAGCGGTCTCCAGGGCGG 0: 1
1: 0
2: 0
3: 9
4: 92
1159797831_1159797841 19 Left 1159797831 18:72866718-72866740 CCTCTACACTGCCCGCGTTACCA 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1159797841 18:72866760-72866782 CAGCGGTCTCCAGGGCGGAAAGG 0: 1
1: 0
2: 1
3: 9
4: 94
1159797831_1159797842 20 Left 1159797831 18:72866718-72866740 CCTCTACACTGCCCGCGTTACCA 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1159797842 18:72866761-72866783 AGCGGTCTCCAGGGCGGAAAGGG 0: 1
1: 0
2: 0
3: 7
4: 90
1159797831_1159797838 10 Left 1159797831 18:72866718-72866740 CCTCTACACTGCCCGCGTTACCA 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1159797838 18:72866751-72866773 AAGCGACATCAGCGGTCTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 60
1159797831_1159797835 2 Left 1159797831 18:72866718-72866740 CCTCTACACTGCCCGCGTTACCA 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1159797835 18:72866743-72866765 CACCCATAAAGCGACATCAGCGG 0: 1
1: 0
2: 0
3: 4
4: 41
1159797831_1159797839 11 Left 1159797831 18:72866718-72866740 CCTCTACACTGCCCGCGTTACCA 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1159797839 18:72866752-72866774 AGCGACATCAGCGGTCTCCAGGG 0: 1
1: 0
2: 1
3: 8
4: 60
1159797831_1159797843 21 Left 1159797831 18:72866718-72866740 CCTCTACACTGCCCGCGTTACCA 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1159797843 18:72866762-72866784 GCGGTCTCCAGGGCGGAAAGGGG 0: 1
1: 0
2: 0
3: 13
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159797831 Original CRISPR TGGTAACGCGGGCAGTGTAG AGG (reversed) Intronic
900746666 1:4365548-4365570 TGGTGACCCGGGCAGTGGACAGG + Intergenic
905167648 1:36092356-36092378 TGGTGGCGCGGGCAGGGGAGAGG - Intronic
905973948 1:42162243-42162265 TGGGAAGACGGGCAGTGGAGAGG + Intergenic
908254230 1:62289536-62289558 TGGACACGCAGGCAGTGTACTGG - Intronic
920187027 1:204166168-204166190 TGGTAACTCAGGCAGAGAAGGGG - Intronic
922474558 1:225898338-225898360 TGTTAACGAGAGCACTGTAGGGG + Intronic
924247619 1:242100270-242100292 TGGGAAGGCAGGCAGTGGAGTGG - Intronic
1069100486 10:64314342-64314364 TGTTATTGTGGGCAGTGTAGAGG - Intergenic
1077554248 11:3218335-3218357 TGGTAGCGCGGGCAGACCAGGGG + Exonic
1089630229 11:119779755-119779777 TGGGAACTCTGGCAGTGTAAAGG + Intergenic
1096029220 12:48397092-48397114 TGTTAATGGGGGCAGGGTAGAGG + Intergenic
1105240095 13:18600404-18600426 TGGTGACGCGGGCAGGGTCAGGG + Intergenic
1122647084 14:103201999-103202021 TGGAAACGTGGCCAGTGCAGGGG + Intergenic
1123491142 15:20783681-20783703 TGGTGACGCGGGCAGGGTCAGGG - Intergenic
1123547644 15:21352772-21352794 TGGTGACGCGGGCAGGGTCAGGG - Intergenic
1124973816 15:34515076-34515098 GGGTGACGGGGGCAGGGTAGGGG - Intergenic
1125297371 15:38217806-38217828 AGGGAACGTGGGCAGTGAAGGGG - Intergenic
1202955974 15_KI270727v1_random:80002-80024 TGGTGACGCGGGCAGGGTCAGGG - Intergenic
1141886717 16:86897302-86897324 TGCCAACGCTGGCATTGTAGAGG + Intergenic
1144081233 17:11766127-11766149 TTTTAATGCAGGCAGTGTAGGGG - Intronic
1146313607 17:31790012-31790034 TGGTAAGGTGGGCAGAGGAGGGG - Intergenic
1154448736 18:14458370-14458392 TGGTGACGCGGGCAGGGTCAGGG - Intergenic
1159797831 18:72866718-72866740 TGGTAACGCGGGCAGTGTAGAGG - Intronic
1168246070 19:55113733-55113755 TGGAAACTCGGGCTGTGAAGGGG + Intronic
947705194 2:232269192-232269214 TGGCAATGGGGGCAGTGTGGGGG - Intronic
1176447487 21:6832152-6832174 TGGTGACGCGGGCAGGGTCAGGG + Intergenic
1176825656 21:13697178-13697200 TGGTGACGCGGGCAGGGTCAGGG + Intergenic
1178248755 21:30980725-30980747 TGGTAAAGCTGGCTGTGCAGGGG - Intergenic
1203303679 22_KI270736v1_random:94603-94625 TGGAATGGAGGGCAGTGTAGTGG + Intergenic
959140098 3:102475300-102475322 TGGTAATACGGGGAGTGCAGGGG + Intronic
969365023 4:6689387-6689409 AGGAAACGCGGGCAGGGTGGAGG + Intergenic
970246150 4:14065950-14065972 TGGTAACAAGGCCAGTGTTGGGG + Intergenic
973971765 4:56220080-56220102 TGGTAACGTAGGCAGGGCAGTGG + Intronic
985395207 4:189536722-189536744 TGGTAACGGGGGCAGTCTTGGGG - Intergenic
986161553 5:5234157-5234179 TGGTAATGCGGGCAGCGCAAGGG - Intronic
993113038 5:83683344-83683366 TGGTAGTGAGGGCAGTGTAGAGG + Intronic
1001483035 5:172101697-172101719 TGGGAATGTGGGGAGTGTAGTGG + Intronic
1006096210 6:31658437-31658459 TGGTAGCTCAGGCAGTGTGGGGG - Exonic
1007844053 6:44739364-44739386 TGGTCCCGCGGGCAGGGTGGCGG + Intergenic
1011113688 6:83866526-83866548 TGGAACCGGGAGCAGTGTAGAGG - Intronic
1034860130 7:154587779-154587801 TAGTCACGCAGGCAGTGAAGAGG - Intronic
1036196773 8:6724264-6724286 TGGGAACATGGGCAGTGTCGCGG - Intronic
1036813686 8:11885673-11885695 TGGACAGGCGGGCAGTGAAGAGG + Intergenic
1042056825 8:64772823-64772845 TGGTAAGGAGGCCAGTGTTGTGG - Intronic
1050405687 9:5306434-5306456 TGGGAAAGCGGGCATTGTACTGG - Intergenic
1054779301 9:69151748-69151770 TGGCAACGTGGGCCGTGTACTGG - Intronic
1059309306 9:113377268-113377290 TGGTAACGGGGGCTGCGGAGCGG - Intergenic
1203521704 Un_GL000213v1:52379-52401 TGGTGACGCGGGCAGGGTCAGGG - Intergenic
1199935972 X:152574006-152574028 TTGTAATGCTGGCAGGGTAGAGG - Intergenic