ID: 1159797971

View in Genome Browser
Species Human (GRCh38)
Location 18:72867322-72867344
Sequence CCGTCTCTAAATGGAATTAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 67}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159797971_1159797981 2 Left 1159797971 18:72867322-72867344 CCACTAATTCCATTTAGAGACGG 0: 1
1: 0
2: 1
3: 6
4: 67
Right 1159797981 18:72867347-72867369 AGACTTCCAGTGGCGGGGGGAGG 0: 1
1: 0
2: 1
3: 21
4: 252
1159797971_1159797975 -8 Left 1159797971 18:72867322-72867344 CCACTAATTCCATTTAGAGACGG 0: 1
1: 0
2: 1
3: 6
4: 67
Right 1159797975 18:72867337-72867359 AGAGACGGGAAGACTTCCAGTGG 0: 1
1: 0
2: 1
3: 18
4: 178
1159797971_1159797982 7 Left 1159797971 18:72867322-72867344 CCACTAATTCCATTTAGAGACGG 0: 1
1: 0
2: 1
3: 6
4: 67
Right 1159797982 18:72867352-72867374 TCCAGTGGCGGGGGGAGGACAGG 0: 1
1: 0
2: 0
3: 22
4: 326
1159797971_1159797977 -4 Left 1159797971 18:72867322-72867344 CCACTAATTCCATTTAGAGACGG 0: 1
1: 0
2: 1
3: 6
4: 67
Right 1159797977 18:72867341-72867363 ACGGGAAGACTTCCAGTGGCGGG 0: 1
1: 0
2: 0
3: 8
4: 81
1159797971_1159797976 -5 Left 1159797971 18:72867322-72867344 CCACTAATTCCATTTAGAGACGG 0: 1
1: 0
2: 1
3: 6
4: 67
Right 1159797976 18:72867340-72867362 GACGGGAAGACTTCCAGTGGCGG 0: 1
1: 0
2: 0
3: 9
4: 92
1159797971_1159797978 -3 Left 1159797971 18:72867322-72867344 CCACTAATTCCATTTAGAGACGG 0: 1
1: 0
2: 1
3: 6
4: 67
Right 1159797978 18:72867342-72867364 CGGGAAGACTTCCAGTGGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 80
1159797971_1159797979 -2 Left 1159797971 18:72867322-72867344 CCACTAATTCCATTTAGAGACGG 0: 1
1: 0
2: 1
3: 6
4: 67
Right 1159797979 18:72867343-72867365 GGGAAGACTTCCAGTGGCGGGGG 0: 1
1: 0
2: 1
3: 10
4: 150
1159797971_1159797984 8 Left 1159797971 18:72867322-72867344 CCACTAATTCCATTTAGAGACGG 0: 1
1: 0
2: 1
3: 6
4: 67
Right 1159797984 18:72867353-72867375 CCAGTGGCGGGGGGAGGACAGGG 0: 1
1: 0
2: 3
3: 43
4: 487
1159797971_1159797980 -1 Left 1159797971 18:72867322-72867344 CCACTAATTCCATTTAGAGACGG 0: 1
1: 0
2: 1
3: 6
4: 67
Right 1159797980 18:72867344-72867366 GGAAGACTTCCAGTGGCGGGGGG 0: 1
1: 0
2: 1
3: 8
4: 129
1159797971_1159797985 16 Left 1159797971 18:72867322-72867344 CCACTAATTCCATTTAGAGACGG 0: 1
1: 0
2: 1
3: 6
4: 67
Right 1159797985 18:72867361-72867383 GGGGGGAGGACAGGGTCGAGAGG 0: 1
1: 0
2: 3
3: 41
4: 605

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159797971 Original CRISPR CCGTCTCTAAATGGAATTAG TGG (reversed) Exonic
901561569 1:10075879-10075901 CCGTCTCTACAAAAAATTAGCGG + Intronic
901674932 1:10877624-10877646 CTGTCTCTAAAAGGAACCAGAGG + Intergenic
906987823 1:50705374-50705396 CTGTTTCTAAAAGGAATTTGAGG - Intronic
916748277 1:167701165-167701187 CCATCTCTGAATGGAATGAGAGG + Intronic
918664853 1:187138141-187138163 CGGTGTTGAAATGGAATTAGTGG + Intergenic
924676575 1:246184580-246184602 CCTTCTCCAAATAGAATCAGAGG - Intronic
1064617515 10:17176673-17176695 CCTTCTCAAAATAGAATTGGGGG + Intronic
1069030029 10:63586174-63586196 CACTCTCTCAAAGGAATTAGAGG - Intronic
1076470130 10:130713027-130713049 TTCTCTCTAAATGGACTTAGCGG - Intergenic
1083294759 11:61709404-61709426 CCGTCTCTACAAAAAATTAGCGG - Intronic
1085814003 11:79716617-79716639 CTGTCTCTAAATGGAATCAGAGG - Intergenic
1086986243 11:93252220-93252242 CTTTCTCTAAAAGGAATTACAGG + Intergenic
1090977140 11:131687990-131688012 CCTCCTCTGAATGGAAATAGTGG + Intronic
1091027504 11:132155287-132155309 CCTTCTCCAAATCGAATTATGGG - Intronic
1092914121 12:13174076-13174098 CAGTCTCTAAATGGAAAAGGAGG - Intergenic
1097519312 12:60647566-60647588 CTGTCTCTAAACTGAATCAGGGG + Intergenic
1105961921 13:25349855-25349877 CCTTCTATACATTGAATTAGTGG - Intergenic
1106936860 13:34731860-34731882 CCTTCTAAAAATGGAATTTGAGG - Intergenic
1107568566 13:41631927-41631949 CTGTCTCTCAATCTAATTAGCGG - Intronic
1109179031 13:59190835-59190857 CAGTCACCAACTGGAATTAGAGG + Intergenic
1111012068 13:82326365-82326387 CCGTCCCTTGATGGAATCAGGGG - Intergenic
1111795268 13:92911138-92911160 CTGTCTGTAAATGAAATTTGGGG + Intergenic
1113933196 13:113979341-113979363 CAGACTTTAAATGGAATGAGTGG + Exonic
1115188283 14:30717719-30717741 CCGTCTCTACAAAAAATTAGTGG + Intronic
1115951331 14:38725652-38725674 CATTCTCTAAAGGCAATTAGAGG + Intergenic
1131279864 15:91012302-91012324 CCTTCTGTAAAAGGAATAAGAGG - Intronic
1131323726 15:91422203-91422225 TCTCCTCTAAATGGCATTAGGGG - Intergenic
1146740883 17:35282545-35282567 CCTTATCTAAACGGAAGTAGTGG + Intergenic
1147546621 17:41406907-41406929 CTGTGTTTAAATGGAATCAGTGG - Intergenic
1153433626 18:5045608-5045630 CAGTTTCTACATGGAATTAGGGG - Intergenic
1153738372 18:8096547-8096569 CCGTCTTTAAATGTTAATAGTGG + Intronic
1155809814 18:30217688-30217710 CTCTCTCTAAATAGAATTATAGG + Intergenic
1157022901 18:43808225-43808247 CAGTCCCTAAATGGAACAAGGGG + Intergenic
1159797971 18:72867322-72867344 CCGTCTCTAAATGGAATTAGTGG - Exonic
1161965773 19:7547640-7547662 CCGTCTCTAAAATAAATTAAAGG - Intronic
1163254946 19:16150237-16150259 CCATCTCTAAAAGGAATTTTAGG + Intronic
1164498555 19:28793007-28793029 ACGTTTCTGAATGGAATTGGAGG - Intergenic
929824634 2:45300695-45300717 CAGCCTCTAAATGAATTTAGAGG + Intergenic
931768022 2:65474113-65474135 GCGTCTCTCAATGGACCTAGTGG - Intergenic
932655325 2:73606363-73606385 CAGTCACAAAATGGAATTAGGGG + Intronic
936990858 2:118364581-118364603 CTGTCTCTCAATGGAAGAAGGGG - Intergenic
939514685 2:143151822-143151844 CCCTGTCTAATTGGAATGAGAGG + Intronic
948392848 2:237625297-237625319 CCGCCTCTAAATGGAAATACGGG - Intergenic
1169463211 20:5814822-5814844 CCGTCTCTACAAAAAATTAGTGG - Intronic
1172493125 20:35357512-35357534 CCGTCTCAAAAAAAAATTAGTGG + Intronic
1178346428 21:31832464-31832486 CTCTGTCTAAATGGACTTAGCGG - Intergenic
1178981846 21:37270928-37270950 CCCTTCCCAAATGGAATTAGTGG - Intergenic
953621867 3:44539995-44540017 CTGTCTCCAAATGGACATAGTGG + Intergenic
973793583 4:54400920-54400942 CCCTCTCTTCATGGAGTTAGAGG - Intergenic
981447192 4:144853693-144853715 CAGTATGTAAATGGAAATAGAGG - Intergenic
982980212 4:162124191-162124213 CTATCTCTAAATTTAATTAGAGG - Intronic
984537006 4:180989242-180989264 CCCTCTGTAAGTGGAATGAGGGG - Intergenic
987509118 5:18813533-18813555 CTGTCTCTAAAGAGAATTATAGG - Intergenic
991732066 5:69599139-69599161 ACCTCTCTAAATGGGATTACAGG - Intergenic
991808499 5:70454282-70454304 ACCTCTCTAAATGGGATTACAGG - Intergenic
991862885 5:71028719-71028741 ACCTCTCTAAATGGGATTACAGG + Intergenic
994360416 5:98843766-98843788 CTCTCTAAAAATGGAATTAGTGG + Intergenic
996168153 5:120251988-120252010 TCGTCTCCAAATGTTATTAGAGG - Intergenic
1014137198 6:117904123-117904145 TAGTCTATAAATGGTATTAGTGG - Intergenic
1015297568 6:131615244-131615266 TATTCTCTAAATGGAATCAGTGG + Intronic
1020628066 7:10607497-10607519 CCTTCTCTAGATGGAAGCAGAGG - Intergenic
1025868162 7:65405456-65405478 CTGTCTCTCAACTGAATTAGGGG - Intergenic
1029675268 7:102064343-102064365 CCGGCTCTAAATGGTTTTAAGGG + Intronic
1031625442 7:123987086-123987108 CCTCATCTAAATGGAATTTGAGG - Intergenic
1044832637 8:96264890-96264912 CTGTCTCTTTATGAAATTAGTGG - Intronic
1047103947 8:121712587-121712609 CCGTATTTAAGTGGAATCAGTGG + Intergenic
1054974311 9:71124040-71124062 CCCTCTCTAATGGCAATTAGAGG + Intronic
1056361400 9:85861278-85861300 CCATCTCTAGATGGAGTTAGTGG + Intergenic
1057674622 9:97129072-97129094 CCCTGTATAAATGGACTTAGCGG + Intergenic
1058597928 9:106635755-106635777 CCAGTTCCAAATGGAATTAGAGG - Intergenic
1060350591 9:122855303-122855325 CCATCACTAAAGGGAATTATTGG + Exonic
1061175920 9:128996879-128996901 CATTCTCTTAATGGCATTAGTGG + Intronic
1187857857 X:23654498-23654520 CCTTCTCTAAATGGAACTGGAGG - Intergenic
1190048524 X:47131905-47131927 CCTTATCTTAATGGATTTAGGGG + Intergenic
1197353533 X:125405461-125405483 CCATATCTAAATTGAATAAGGGG + Intergenic