ID: 1159798222

View in Genome Browser
Species Human (GRCh38)
Location 18:72868194-72868216
Sequence GCTGCGCGCGGCCGGCGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159798210_1159798222 13 Left 1159798210 18:72868158-72868180 CCTCCTGGAAGCCCGGAGCCTGG No data
Right 1159798222 18:72868194-72868216 GCTGCGCGCGGCCGGCGCCCCGG No data
1159798219_1159798222 -5 Left 1159798219 18:72868176-72868198 CCTGGGTGGGATAGCGAGGCTGC No data
Right 1159798222 18:72868194-72868216 GCTGCGCGCGGCCGGCGCCCCGG No data
1159798213_1159798222 10 Left 1159798213 18:72868161-72868183 CCTGGAAGCCCGGAGCCTGGGTG No data
Right 1159798222 18:72868194-72868216 GCTGCGCGCGGCCGGCGCCCCGG No data
1159798209_1159798222 14 Left 1159798209 18:72868157-72868179 CCCTCCTGGAAGCCCGGAGCCTG No data
Right 1159798222 18:72868194-72868216 GCTGCGCGCGGCCGGCGCCCCGG No data
1159798216_1159798222 2 Left 1159798216 18:72868169-72868191 CCCGGAGCCTGGGTGGGATAGCG No data
Right 1159798222 18:72868194-72868216 GCTGCGCGCGGCCGGCGCCCCGG No data
1159798207_1159798222 20 Left 1159798207 18:72868151-72868173 CCACGACCCTCCTGGAAGCCCGG No data
Right 1159798222 18:72868194-72868216 GCTGCGCGCGGCCGGCGCCCCGG No data
1159798217_1159798222 1 Left 1159798217 18:72868170-72868192 CCGGAGCCTGGGTGGGATAGCGA No data
Right 1159798222 18:72868194-72868216 GCTGCGCGCGGCCGGCGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159798222 Original CRISPR GCTGCGCGCGGCCGGCGCCC CGG Intergenic
No off target data available for this crispr