ID: 1159798321

View in Genome Browser
Species Human (GRCh38)
Location 18:72868540-72868562
Sequence GCGAAACCTGCGCCCCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159798321_1159798333 26 Left 1159798321 18:72868540-72868562 CCTCCCTGGGGCGCAGGTTTCGC No data
Right 1159798333 18:72868589-72868611 ACACGGCAGGGGCGCGCCCCAGG No data
1159798321_1159798327 1 Left 1159798321 18:72868540-72868562 CCTCCCTGGGGCGCAGGTTTCGC No data
Right 1159798327 18:72868564-72868586 GCGGACTCCGCGCTCAGCTTGGG No data
1159798321_1159798334 27 Left 1159798321 18:72868540-72868562 CCTCCCTGGGGCGCAGGTTTCGC No data
Right 1159798334 18:72868590-72868612 CACGGCAGGGGCGCGCCCCAGGG No data
1159798321_1159798326 0 Left 1159798321 18:72868540-72868562 CCTCCCTGGGGCGCAGGTTTCGC No data
Right 1159798326 18:72868563-72868585 CGCGGACTCCGCGCTCAGCTTGG No data
1159798321_1159798331 14 Left 1159798321 18:72868540-72868562 CCTCCCTGGGGCGCAGGTTTCGC No data
Right 1159798331 18:72868577-72868599 TCAGCTTGGGAGACACGGCAGGG No data
1159798321_1159798332 15 Left 1159798321 18:72868540-72868562 CCTCCCTGGGGCGCAGGTTTCGC No data
Right 1159798332 18:72868578-72868600 CAGCTTGGGAGACACGGCAGGGG No data
1159798321_1159798329 9 Left 1159798321 18:72868540-72868562 CCTCCCTGGGGCGCAGGTTTCGC No data
Right 1159798329 18:72868572-72868594 CGCGCTCAGCTTGGGAGACACGG No data
1159798321_1159798330 13 Left 1159798321 18:72868540-72868562 CCTCCCTGGGGCGCAGGTTTCGC No data
Right 1159798330 18:72868576-72868598 CTCAGCTTGGGAGACACGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159798321 Original CRISPR GCGAAACCTGCGCCCCAGGG AGG (reversed) Intergenic