ID: 1159799366 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 18:72878613-72878635 |
Sequence | TGTTCCAATAATCCCATCAA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1159799366_1159799374 | 29 | Left | 1159799366 | 18:72878613-72878635 | CCATTGATGGGATTATTGGAACA | No data | ||
Right | 1159799374 | 18:72878665-72878687 | ATTGCTAAGGCTTTTGCCTGTGG | No data | ||||
1159799366_1159799371 | 16 | Left | 1159799366 | 18:72878613-72878635 | CCATTGATGGGATTATTGGAACA | No data | ||
Right | 1159799371 | 18:72878652-72878674 | TTATCCCATCACAATTGCTAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1159799366 | Original CRISPR | TGTTCCAATAATCCCATCAA TGG (reversed) | Intergenic | ||