ID: 1159799366 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:72878613-72878635 |
| Sequence | TGTTCCAATAATCCCATCAA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1159799366_1159799374 | 29 | Left | 1159799366 | 18:72878613-72878635 | CCATTGATGGGATTATTGGAACA | No data | ||
| Right | 1159799374 | 18:72878665-72878687 | ATTGCTAAGGCTTTTGCCTGTGG | No data | ||||
| 1159799366_1159799371 | 16 | Left | 1159799366 | 18:72878613-72878635 | CCATTGATGGGATTATTGGAACA | No data | ||
| Right | 1159799371 | 18:72878652-72878674 | TTATCCCATCACAATTGCTAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1159799366 | Original CRISPR | TGTTCCAATAATCCCATCAA TGG (reversed) | Intergenic | ||