ID: 1159799366

View in Genome Browser
Species Human (GRCh38)
Location 18:72878613-72878635
Sequence TGTTCCAATAATCCCATCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159799366_1159799371 16 Left 1159799366 18:72878613-72878635 CCATTGATGGGATTATTGGAACA No data
Right 1159799371 18:72878652-72878674 TTATCCCATCACAATTGCTAAGG No data
1159799366_1159799374 29 Left 1159799366 18:72878613-72878635 CCATTGATGGGATTATTGGAACA No data
Right 1159799374 18:72878665-72878687 ATTGCTAAGGCTTTTGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159799366 Original CRISPR TGTTCCAATAATCCCATCAA TGG (reversed) Intergenic
No off target data available for this crispr