ID: 1159799368

View in Genome Browser
Species Human (GRCh38)
Location 18:72878642-72878664
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159799368_1159799376 9 Left 1159799368 18:72878642-72878664 CCCCGGCATGTTATCCCATCACA No data
Right 1159799376 18:72878674-72878696 GCTTTTGCCTGTGGAAAACTGGG No data
1159799368_1159799375 8 Left 1159799368 18:72878642-72878664 CCCCGGCATGTTATCCCATCACA No data
Right 1159799375 18:72878673-72878695 GGCTTTTGCCTGTGGAAAACTGG No data
1159799368_1159799374 0 Left 1159799368 18:72878642-72878664 CCCCGGCATGTTATCCCATCACA No data
Right 1159799374 18:72878665-72878687 ATTGCTAAGGCTTTTGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159799368 Original CRISPR TGTGATGGGATAACATGCCG GGG (reversed) Intergenic