ID: 1159799370

View in Genome Browser
Species Human (GRCh38)
Location 18:72878644-72878666
Sequence ATTGTGATGGGATAACATGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159799370_1159799374 -2 Left 1159799370 18:72878644-72878666 CCGGCATGTTATCCCATCACAAT No data
Right 1159799374 18:72878665-72878687 ATTGCTAAGGCTTTTGCCTGTGG No data
1159799370_1159799375 6 Left 1159799370 18:72878644-72878666 CCGGCATGTTATCCCATCACAAT No data
Right 1159799375 18:72878673-72878695 GGCTTTTGCCTGTGGAAAACTGG No data
1159799370_1159799376 7 Left 1159799370 18:72878644-72878666 CCGGCATGTTATCCCATCACAAT No data
Right 1159799376 18:72878674-72878696 GCTTTTGCCTGTGGAAAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159799370 Original CRISPR ATTGTGATGGGATAACATGC CGG (reversed) Intergenic
No off target data available for this crispr