ID: 1159799371

View in Genome Browser
Species Human (GRCh38)
Location 18:72878652-72878674
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159799366_1159799371 16 Left 1159799366 18:72878613-72878635 CCATTGATGGGATTATTGGAACA No data
Right 1159799371 18:72878652-72878674 TTATCCCATCACAATTGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159799371 Original CRISPR TTATCCCATCACAATTGCTA AGG Intergenic
No off target data available for this crispr