ID: 1159799372

View in Genome Browser
Species Human (GRCh38)
Location 18:72878656-72878678
Sequence AAAGCCTTAGCAATTGTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159799372_1159799378 21 Left 1159799372 18:72878656-72878678 CCCATCACAATTGCTAAGGCTTT No data
Right 1159799378 18:72878700-72878722 GAAAATAGAACAGTGTGCCCTGG No data
1159799372_1159799376 -5 Left 1159799372 18:72878656-72878678 CCCATCACAATTGCTAAGGCTTT No data
Right 1159799376 18:72878674-72878696 GCTTTTGCCTGTGGAAAACTGGG No data
1159799372_1159799375 -6 Left 1159799372 18:72878656-72878678 CCCATCACAATTGCTAAGGCTTT No data
Right 1159799375 18:72878673-72878695 GGCTTTTGCCTGTGGAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159799372 Original CRISPR AAAGCCTTAGCAATTGTGAT GGG (reversed) Intergenic
No off target data available for this crispr