ID: 1159799374

View in Genome Browser
Species Human (GRCh38)
Location 18:72878665-72878687
Sequence ATTGCTAAGGCTTTTGCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159799369_1159799374 -1 Left 1159799369 18:72878643-72878665 CCCGGCATGTTATCCCATCACAA No data
Right 1159799374 18:72878665-72878687 ATTGCTAAGGCTTTTGCCTGTGG No data
1159799368_1159799374 0 Left 1159799368 18:72878642-72878664 CCCCGGCATGTTATCCCATCACA No data
Right 1159799374 18:72878665-72878687 ATTGCTAAGGCTTTTGCCTGTGG No data
1159799370_1159799374 -2 Left 1159799370 18:72878644-72878666 CCGGCATGTTATCCCATCACAAT No data
Right 1159799374 18:72878665-72878687 ATTGCTAAGGCTTTTGCCTGTGG No data
1159799366_1159799374 29 Left 1159799366 18:72878613-72878635 CCATTGATGGGATTATTGGAACA No data
Right 1159799374 18:72878665-72878687 ATTGCTAAGGCTTTTGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159799374 Original CRISPR ATTGCTAAGGCTTTTGCCTG TGG Intergenic
No off target data available for this crispr