ID: 1159799375

View in Genome Browser
Species Human (GRCh38)
Location 18:72878673-72878695
Sequence GGCTTTTGCCTGTGGAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159799368_1159799375 8 Left 1159799368 18:72878642-72878664 CCCCGGCATGTTATCCCATCACA No data
Right 1159799375 18:72878673-72878695 GGCTTTTGCCTGTGGAAAACTGG No data
1159799370_1159799375 6 Left 1159799370 18:72878644-72878666 CCGGCATGTTATCCCATCACAAT No data
Right 1159799375 18:72878673-72878695 GGCTTTTGCCTGTGGAAAACTGG No data
1159799373_1159799375 -7 Left 1159799373 18:72878657-72878679 CCATCACAATTGCTAAGGCTTTT No data
Right 1159799375 18:72878673-72878695 GGCTTTTGCCTGTGGAAAACTGG No data
1159799372_1159799375 -6 Left 1159799372 18:72878656-72878678 CCCATCACAATTGCTAAGGCTTT No data
Right 1159799375 18:72878673-72878695 GGCTTTTGCCTGTGGAAAACTGG No data
1159799369_1159799375 7 Left 1159799369 18:72878643-72878665 CCCGGCATGTTATCCCATCACAA No data
Right 1159799375 18:72878673-72878695 GGCTTTTGCCTGTGGAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159799375 Original CRISPR GGCTTTTGCCTGTGGAAAAC TGG Intergenic
No off target data available for this crispr