ID: 1159801096

View in Genome Browser
Species Human (GRCh38)
Location 18:72900122-72900144
Sequence GATGACTGATGAGCAAAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159801094_1159801096 -7 Left 1159801094 18:72900106-72900128 CCCTGGCTTGTTATTGGATGACT No data
Right 1159801096 18:72900122-72900144 GATGACTGATGAGCAAAGAATGG No data
1159801092_1159801096 1 Left 1159801092 18:72900098-72900120 CCGTGGGTCCCTGGCTTGTTATT No data
Right 1159801096 18:72900122-72900144 GATGACTGATGAGCAAAGAATGG No data
1159801095_1159801096 -8 Left 1159801095 18:72900107-72900129 CCTGGCTTGTTATTGGATGACTG No data
Right 1159801096 18:72900122-72900144 GATGACTGATGAGCAAAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159801096 Original CRISPR GATGACTGATGAGCAAAGAA TGG Intergenic
No off target data available for this crispr