ID: 1159802680

View in Genome Browser
Species Human (GRCh38)
Location 18:72920395-72920417
Sequence AGGGAGAGCACAGTCATTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159802680_1159802689 26 Left 1159802680 18:72920395-72920417 CCCATAATGACTGTGCTCTCCCT No data
Right 1159802689 18:72920444-72920466 ACACCACATGGCCACTGCCAGGG No data
1159802680_1159802690 27 Left 1159802680 18:72920395-72920417 CCCATAATGACTGTGCTCTCCCT No data
Right 1159802690 18:72920445-72920467 CACCACATGGCCACTGCCAGGGG 0: 4
1: 6
2: 24
3: 62
4: 295
1159802680_1159802686 14 Left 1159802680 18:72920395-72920417 CCCATAATGACTGTGCTCTCCCT No data
Right 1159802686 18:72920432-72920454 CATTCTCTCTCCACACCACATGG No data
1159802680_1159802688 25 Left 1159802680 18:72920395-72920417 CCCATAATGACTGTGCTCTCCCT No data
Right 1159802688 18:72920443-72920465 CACACCACATGGCCACTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159802680 Original CRISPR AGGGAGAGCACAGTCATTAT GGG (reversed) Intergenic
No off target data available for this crispr