ID: 1159813974

View in Genome Browser
Species Human (GRCh38)
Location 18:73050705-73050727
Sequence AAAGCCTAGTGAACACATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159813972_1159813974 13 Left 1159813972 18:73050669-73050691 CCAAAATTCATGAAAAGTTTGAA No data
Right 1159813974 18:73050705-73050727 AAAGCCTAGTGAACACATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159813974 Original CRISPR AAAGCCTAGTGAACACATAT GGG Intergenic
No off target data available for this crispr