ID: 1159816617

View in Genome Browser
Species Human (GRCh38)
Location 18:73081851-73081873
Sequence AGACAAATTCAACAACTGAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159816615_1159816617 -8 Left 1159816615 18:73081836-73081858 CCTAAGGTATTACCTAGACAAAT No data
Right 1159816617 18:73081851-73081873 AGACAAATTCAACAACTGATCGG No data
1159816613_1159816617 20 Left 1159816613 18:73081808-73081830 CCAAAGTAAAATTGTCTCATAAA No data
Right 1159816617 18:73081851-73081873 AGACAAATTCAACAACTGATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159816617 Original CRISPR AGACAAATTCAACAACTGAT CGG Intergenic