ID: 1159816617 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 18:73081851-73081873 |
Sequence | AGACAAATTCAACAACTGAT CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1159816615_1159816617 | -8 | Left | 1159816615 | 18:73081836-73081858 | CCTAAGGTATTACCTAGACAAAT | No data | ||
Right | 1159816617 | 18:73081851-73081873 | AGACAAATTCAACAACTGATCGG | No data | ||||
1159816613_1159816617 | 20 | Left | 1159816613 | 18:73081808-73081830 | CCAAAGTAAAATTGTCTCATAAA | No data | ||
Right | 1159816617 | 18:73081851-73081873 | AGACAAATTCAACAACTGATCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1159816617 | Original CRISPR | AGACAAATTCAACAACTGAT CGG | Intergenic | ||