ID: 1159819676

View in Genome Browser
Species Human (GRCh38)
Location 18:73124370-73124392
Sequence TGACAGCTGAAAATAATTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159819676_1159819678 1 Left 1159819676 18:73124370-73124392 CCATAAATTATTTTCAGCTGTCA No data
Right 1159819678 18:73124394-73124416 TGGACCTGTTGATGAGCACCAGG No data
1159819676_1159819680 14 Left 1159819676 18:73124370-73124392 CCATAAATTATTTTCAGCTGTCA No data
Right 1159819680 18:73124407-73124429 GAGCACCAGGAGCCTTCTCCTGG No data
1159819676_1159819684 28 Left 1159819676 18:73124370-73124392 CCATAAATTATTTTCAGCTGTCA No data
Right 1159819684 18:73124421-73124443 TTCTCCTGGTACATGGTTCCAGG No data
1159819676_1159819682 21 Left 1159819676 18:73124370-73124392 CCATAAATTATTTTCAGCTGTCA No data
Right 1159819682 18:73124414-73124436 AGGAGCCTTCTCCTGGTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159819676 Original CRISPR TGACAGCTGAAAATAATTTA TGG (reversed) Intergenic
No off target data available for this crispr