ID: 1159819679

View in Genome Browser
Species Human (GRCh38)
Location 18:73124398-73124420
Sequence GGCTCCTGGTGCTCATCAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159819679_1159819682 -7 Left 1159819679 18:73124398-73124420 CCTGTTGATGAGCACCAGGAGCC No data
Right 1159819682 18:73124414-73124436 AGGAGCCTTCTCCTGGTACATGG No data
1159819679_1159819688 22 Left 1159819679 18:73124398-73124420 CCTGTTGATGAGCACCAGGAGCC No data
Right 1159819688 18:73124443-73124465 GAATGATATTTATGGTAAGAAGG No data
1159819679_1159819684 0 Left 1159819679 18:73124398-73124420 CCTGTTGATGAGCACCAGGAGCC No data
Right 1159819684 18:73124421-73124443 TTCTCCTGGTACATGGTTCCAGG No data
1159819679_1159819686 14 Left 1159819679 18:73124398-73124420 CCTGTTGATGAGCACCAGGAGCC No data
Right 1159819686 18:73124435-73124457 GGTTCCAGGAATGATATTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159819679 Original CRISPR GGCTCCTGGTGCTCATCAAC AGG (reversed) Intergenic
No off target data available for this crispr