ID: 1159819682

View in Genome Browser
Species Human (GRCh38)
Location 18:73124414-73124436
Sequence AGGAGCCTTCTCCTGGTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159819676_1159819682 21 Left 1159819676 18:73124370-73124392 CCATAAATTATTTTCAGCTGTCA No data
Right 1159819682 18:73124414-73124436 AGGAGCCTTCTCCTGGTACATGG No data
1159819679_1159819682 -7 Left 1159819679 18:73124398-73124420 CCTGTTGATGAGCACCAGGAGCC No data
Right 1159819682 18:73124414-73124436 AGGAGCCTTCTCCTGGTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159819682 Original CRISPR AGGAGCCTTCTCCTGGTACA TGG Intergenic
No off target data available for this crispr