ID: 1159832407

View in Genome Browser
Species Human (GRCh38)
Location 18:73293549-73293571
Sequence CCCACAACCAGCGTCATCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159832407_1159832414 10 Left 1159832407 18:73293549-73293571 CCTTAGATGACGCTGGTTGTGGG No data
Right 1159832414 18:73293582-73293604 TGGCTTTCCATCCTGATGATGGG No data
1159832407_1159832413 9 Left 1159832407 18:73293549-73293571 CCTTAGATGACGCTGGTTGTGGG No data
Right 1159832413 18:73293581-73293603 CTGGCTTTCCATCCTGATGATGG No data
1159832407_1159832411 -10 Left 1159832407 18:73293549-73293571 CCTTAGATGACGCTGGTTGTGGG No data
Right 1159832411 18:73293562-73293584 TGGTTGTGGGCAGGGAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159832407 Original CRISPR CCCACAACCAGCGTCATCTA AGG (reversed) Intergenic
No off target data available for this crispr