ID: 1159832413

View in Genome Browser
Species Human (GRCh38)
Location 18:73293581-73293603
Sequence CTGGCTTTCCATCCTGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159832407_1159832413 9 Left 1159832407 18:73293549-73293571 CCTTAGATGACGCTGGTTGTGGG No data
Right 1159832413 18:73293581-73293603 CTGGCTTTCCATCCTGATGATGG No data
1159832405_1159832413 13 Left 1159832405 18:73293545-73293567 CCTGCCTTAGATGACGCTGGTTG No data
Right 1159832413 18:73293581-73293603 CTGGCTTTCCATCCTGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159832413 Original CRISPR CTGGCTTTCCATCCTGATGA TGG Intergenic
No off target data available for this crispr