ID: 1159833396

View in Genome Browser
Species Human (GRCh38)
Location 18:73306096-73306118
Sequence CTGGTACTAACTTGGAATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159833393_1159833396 16 Left 1159833393 18:73306057-73306079 CCTCTCAATGCGTTCAATGTTTC No data
Right 1159833396 18:73306096-73306118 CTGGTACTAACTTGGAATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159833396 Original CRISPR CTGGTACTAACTTGGAATTC TGG Intergenic
No off target data available for this crispr