ID: 1159837209

View in Genome Browser
Species Human (GRCh38)
Location 18:73352708-73352730
Sequence GTTCAGCAGCAACACTCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159837209_1159837212 5 Left 1159837209 18:73352708-73352730 CCTGCAGAGTGTTGCTGCTGAAC No data
Right 1159837212 18:73352736-73352758 CACTAATTTGGTATCTCCTTTGG No data
1159837209_1159837210 -7 Left 1159837209 18:73352708-73352730 CCTGCAGAGTGTTGCTGCTGAAC No data
Right 1159837210 18:73352724-73352746 GCTGAACAACCACACTAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159837209 Original CRISPR GTTCAGCAGCAACACTCTGC AGG (reversed) Intergenic