ID: 1159837210

View in Genome Browser
Species Human (GRCh38)
Location 18:73352724-73352746
Sequence GCTGAACAACCACACTAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159837206_1159837210 16 Left 1159837206 18:73352685-73352707 CCAGAGGACCATGGAACACACCT No data
Right 1159837210 18:73352724-73352746 GCTGAACAACCACACTAATTTGG No data
1159837205_1159837210 17 Left 1159837205 18:73352684-73352706 CCCAGAGGACCATGGAACACACC No data
Right 1159837210 18:73352724-73352746 GCTGAACAACCACACTAATTTGG No data
1159837208_1159837210 -4 Left 1159837208 18:73352705-73352727 CCTCCTGCAGAGTGTTGCTGCTG No data
Right 1159837210 18:73352724-73352746 GCTGAACAACCACACTAATTTGG No data
1159837207_1159837210 8 Left 1159837207 18:73352693-73352715 CCATGGAACACACCTCCTGCAGA No data
Right 1159837210 18:73352724-73352746 GCTGAACAACCACACTAATTTGG No data
1159837209_1159837210 -7 Left 1159837209 18:73352708-73352730 CCTGCAGAGTGTTGCTGCTGAAC No data
Right 1159837210 18:73352724-73352746 GCTGAACAACCACACTAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159837210 Original CRISPR GCTGAACAACCACACTAATT TGG Intergenic