ID: 1159837407

View in Genome Browser
Species Human (GRCh38)
Location 18:73355232-73355254
Sequence GTTGCTAGTGAGTCAAAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159837403_1159837407 25 Left 1159837403 18:73355184-73355206 CCATAGCAGAGCCACAGAGATTA No data
Right 1159837407 18:73355232-73355254 GTTGCTAGTGAGTCAAAGGGTGG No data
1159837404_1159837407 14 Left 1159837404 18:73355195-73355217 CCACAGAGATTAAAAATGAGTAT No data
Right 1159837407 18:73355232-73355254 GTTGCTAGTGAGTCAAAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159837407 Original CRISPR GTTGCTAGTGAGTCAAAGGG TGG Intergenic
No off target data available for this crispr