ID: 1159838338

View in Genome Browser
Species Human (GRCh38)
Location 18:73368343-73368365
Sequence CATCATAACATGAAGGTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159838338_1159838341 15 Left 1159838338 18:73368343-73368365 CCTTGTACCTTCATGTTATGATG No data
Right 1159838341 18:73368381-73368403 TACGATGAGTAGTAATAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159838338 Original CRISPR CATCATAACATGAAGGTACA AGG (reversed) Intergenic
No off target data available for this crispr