ID: 1159841824

View in Genome Browser
Species Human (GRCh38)
Location 18:73407055-73407077
Sequence CTGGGGCTCTCACACTCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159841824_1159841833 8 Left 1159841824 18:73407055-73407077 CCCCATGAGTGTGAGAGCCCCAG No data
Right 1159841833 18:73407086-73407108 TGTTGCTAGGTGTCAGAGTGTGG No data
1159841824_1159841830 -5 Left 1159841824 18:73407055-73407077 CCCCATGAGTGTGAGAGCCCCAG No data
Right 1159841830 18:73407073-73407095 CCCAGGCCTGCTTTGTTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159841824 Original CRISPR CTGGGGCTCTCACACTCATG GGG (reversed) Intergenic
No off target data available for this crispr