ID: 1159845764

View in Genome Browser
Species Human (GRCh38)
Location 18:73458094-73458116
Sequence CCTACCACGTAGGAGTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159845764_1159845770 18 Left 1159845764 18:73458094-73458116 CCCCCAAACTCCTACGTGGTAGG No data
Right 1159845770 18:73458135-73458157 CTGTGAAATGAAACTATCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159845764 Original CRISPR CCTACCACGTAGGAGTTTGG GGG (reversed) Intergenic
No off target data available for this crispr