ID: 1159849837

View in Genome Browser
Species Human (GRCh38)
Location 18:73514724-73514746
Sequence GGACCAGGTGTACCACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159849834_1159849837 -5 Left 1159849834 18:73514706-73514728 CCCTGTAAGGCTGCAGCTGGACC No data
Right 1159849837 18:73514724-73514746 GGACCAGGTGTACCACAAGCAGG No data
1159849831_1159849837 12 Left 1159849831 18:73514689-73514711 CCAGCACAGGTGCTGCTCCCTGT No data
Right 1159849837 18:73514724-73514746 GGACCAGGTGTACCACAAGCAGG No data
1159849835_1159849837 -6 Left 1159849835 18:73514707-73514729 CCTGTAAGGCTGCAGCTGGACCA No data
Right 1159849837 18:73514724-73514746 GGACCAGGTGTACCACAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159849837 Original CRISPR GGACCAGGTGTACCACAAGC AGG Intergenic
No off target data available for this crispr