ID: 1159851890

View in Genome Browser
Species Human (GRCh38)
Location 18:73534790-73534812
Sequence CCTCAGTGTCACCAAGTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159851890_1159851897 23 Left 1159851890 18:73534790-73534812 CCCTGGACTTGGTGACACTGAGG No data
Right 1159851897 18:73534836-73534858 ATCTCCCTTATATCTCAGACTGG No data
1159851890_1159851898 24 Left 1159851890 18:73534790-73534812 CCCTGGACTTGGTGACACTGAGG No data
Right 1159851898 18:73534837-73534859 TCTCCCTTATATCTCAGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159851890 Original CRISPR CCTCAGTGTCACCAAGTCCA GGG (reversed) Intergenic
No off target data available for this crispr