ID: 1159856813

View in Genome Browser
Species Human (GRCh38)
Location 18:73598592-73598614
Sequence GGCTGAAAATAGATGGAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159856810_1159856813 14 Left 1159856810 18:73598555-73598577 CCACAGTGACAAGGTTGTTTTGA No data
Right 1159856813 18:73598592-73598614 GGCTGAAAATAGATGGAGTATGG No data
1159856808_1159856813 26 Left 1159856808 18:73598543-73598565 CCATGAGCATGACCACAGTGACA No data
Right 1159856813 18:73598592-73598614 GGCTGAAAATAGATGGAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159856813 Original CRISPR GGCTGAAAATAGATGGAGTA TGG Intergenic
No off target data available for this crispr