ID: 1159856813 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:73598592-73598614 |
| Sequence | GGCTGAAAATAGATGGAGTA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1159856810_1159856813 | 14 | Left | 1159856810 | 18:73598555-73598577 | CCACAGTGACAAGGTTGTTTTGA | No data | ||
| Right | 1159856813 | 18:73598592-73598614 | GGCTGAAAATAGATGGAGTATGG | No data | ||||
| 1159856808_1159856813 | 26 | Left | 1159856808 | 18:73598543-73598565 | CCATGAGCATGACCACAGTGACA | No data | ||
| Right | 1159856813 | 18:73598592-73598614 | GGCTGAAAATAGATGGAGTATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1159856813 | Original CRISPR | GGCTGAAAATAGATGGAGTA TGG | Intergenic | ||
| No off target data available for this crispr | |||||