ID: 1159861116

View in Genome Browser
Species Human (GRCh38)
Location 18:73650862-73650884
Sequence CTTGGACTCCACCACAGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159861116_1159861122 24 Left 1159861116 18:73650862-73650884 CCACTGCTGTGGTGGAGTCCAAG No data
Right 1159861122 18:73650909-73650931 CTGTTCATATGAAGAATTAGGGG No data
1159861116_1159861121 23 Left 1159861116 18:73650862-73650884 CCACTGCTGTGGTGGAGTCCAAG No data
Right 1159861121 18:73650908-73650930 ACTGTTCATATGAAGAATTAGGG No data
1159861116_1159861123 25 Left 1159861116 18:73650862-73650884 CCACTGCTGTGGTGGAGTCCAAG No data
Right 1159861123 18:73650910-73650932 TGTTCATATGAAGAATTAGGGGG No data
1159861116_1159861120 22 Left 1159861116 18:73650862-73650884 CCACTGCTGTGGTGGAGTCCAAG No data
Right 1159861120 18:73650907-73650929 AACTGTTCATATGAAGAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159861116 Original CRISPR CTTGGACTCCACCACAGCAG TGG (reversed) Intergenic
No off target data available for this crispr