ID: 1159861121

View in Genome Browser
Species Human (GRCh38)
Location 18:73650908-73650930
Sequence ACTGTTCATATGAAGAATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159861116_1159861121 23 Left 1159861116 18:73650862-73650884 CCACTGCTGTGGTGGAGTCCAAG No data
Right 1159861121 18:73650908-73650930 ACTGTTCATATGAAGAATTAGGG No data
1159861119_1159861121 5 Left 1159861119 18:73650880-73650902 CCAAGGGTCATAGAGCTCAGAAA No data
Right 1159861121 18:73650908-73650930 ACTGTTCATATGAAGAATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159861121 Original CRISPR ACTGTTCATATGAAGAATTA GGG Intergenic
No off target data available for this crispr