ID: 1159861122

View in Genome Browser
Species Human (GRCh38)
Location 18:73650909-73650931
Sequence CTGTTCATATGAAGAATTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159861119_1159861122 6 Left 1159861119 18:73650880-73650902 CCAAGGGTCATAGAGCTCAGAAA No data
Right 1159861122 18:73650909-73650931 CTGTTCATATGAAGAATTAGGGG No data
1159861116_1159861122 24 Left 1159861116 18:73650862-73650884 CCACTGCTGTGGTGGAGTCCAAG No data
Right 1159861122 18:73650909-73650931 CTGTTCATATGAAGAATTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159861122 Original CRISPR CTGTTCATATGAAGAATTAG GGG Intergenic
No off target data available for this crispr