ID: 1159863922

View in Genome Browser
Species Human (GRCh38)
Location 18:73682448-73682470
Sequence GAAGCAGGTGTAGCACAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159863922_1159863924 0 Left 1159863922 18:73682448-73682470 CCTTTTTGTGCTACACCTGCTTC No data
Right 1159863924 18:73682471-73682493 TACCTAAAACCATTTTGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159863922 Original CRISPR GAAGCAGGTGTAGCACAAAA AGG (reversed) Intergenic
No off target data available for this crispr