ID: 1159864841

View in Genome Browser
Species Human (GRCh38)
Location 18:73691640-73691662
Sequence GCTTAAGCATGTGCACTAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159864835_1159864841 8 Left 1159864835 18:73691609-73691631 CCCAATAACATCTCGGGGGTTGG No data
Right 1159864841 18:73691640-73691662 GCTTAAGCATGTGCACTAAGAGG No data
1159864837_1159864841 7 Left 1159864837 18:73691610-73691632 CCAATAACATCTCGGGGGTTGGG No data
Right 1159864841 18:73691640-73691662 GCTTAAGCATGTGCACTAAGAGG No data
1159864830_1159864841 29 Left 1159864830 18:73691588-73691610 CCTGAAACTAGTGATCGTCTTCC No data
Right 1159864841 18:73691640-73691662 GCTTAAGCATGTGCACTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159864841 Original CRISPR GCTTAAGCATGTGCACTAAG AGG Intergenic
No off target data available for this crispr