ID: 1159868388

View in Genome Browser
Species Human (GRCh38)
Location 18:73732701-73732723
Sequence ACCTCCTAGAAAATAAAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159868387_1159868388 12 Left 1159868387 18:73732666-73732688 CCTGAAAAACTCTTTATAAATTC No data
Right 1159868388 18:73732701-73732723 ACCTCCTAGAAAATAAAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159868388 Original CRISPR ACCTCCTAGAAAATAAAGAA TGG Intergenic
No off target data available for this crispr