ID: 1159869957

View in Genome Browser
Species Human (GRCh38)
Location 18:73750075-73750097
Sequence TTGTTGATGAAAACGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159869952_1159869957 -5 Left 1159869952 18:73750057-73750079 CCTGTGTCCCACATGAATTTGTT No data
Right 1159869957 18:73750075-73750097 TTGTTGATGAAAACGGAGGAAGG No data
1159869951_1159869957 4 Left 1159869951 18:73750048-73750070 CCAGATTCTCCTGTGTCCCACAT No data
Right 1159869957 18:73750075-73750097 TTGTTGATGAAAACGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159869957 Original CRISPR TTGTTGATGAAAACGGAGGA AGG Intergenic
No off target data available for this crispr