ID: 1159878366

View in Genome Browser
Species Human (GRCh38)
Location 18:73834555-73834577
Sequence CCCTGGAGACCTTTATCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159878366_1159878370 14 Left 1159878366 18:73834555-73834577 CCAGGTGATAAAGGTCTCCAGGG No data
Right 1159878370 18:73834592-73834614 CTCAACATTGAAATTACATGAGG No data
1159878366_1159878371 15 Left 1159878366 18:73834555-73834577 CCAGGTGATAAAGGTCTCCAGGG No data
Right 1159878371 18:73834593-73834615 TCAACATTGAAATTACATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159878366 Original CRISPR CCCTGGAGACCTTTATCACC TGG (reversed) Intergenic
No off target data available for this crispr