ID: 1159880597

View in Genome Browser
Species Human (GRCh38)
Location 18:73855177-73855199
Sequence CCTGGCTGCCTGGCAGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159880597_1159880601 -7 Left 1159880597 18:73855177-73855199 CCAGTAGCTGCCAGGCAGCCAGG No data
Right 1159880601 18:73855193-73855215 AGCCAGGGAGCTCCTTGCTCAGG No data
1159880597_1159880608 26 Left 1159880597 18:73855177-73855199 CCAGTAGCTGCCAGGCAGCCAGG No data
Right 1159880608 18:73855226-73855248 TGAGAGTGGCTCAAAGGCACAGG No data
1159880597_1159880605 20 Left 1159880597 18:73855177-73855199 CCAGTAGCTGCCAGGCAGCCAGG No data
Right 1159880605 18:73855220-73855242 AGTCCCTGAGAGTGGCTCAAAGG No data
1159880597_1159880609 27 Left 1159880597 18:73855177-73855199 CCAGTAGCTGCCAGGCAGCCAGG No data
Right 1159880609 18:73855227-73855249 GAGAGTGGCTCAAAGGCACAGGG No data
1159880597_1159880604 12 Left 1159880597 18:73855177-73855199 CCAGTAGCTGCCAGGCAGCCAGG No data
Right 1159880604 18:73855212-73855234 CAGGACTGAGTCCCTGAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159880597 Original CRISPR CCTGGCTGCCTGGCAGCTAC TGG (reversed) Intergenic
No off target data available for this crispr