ID: 1159889458 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 18:73940278-73940300 |
Sequence | CCTTGGGTGTCTGAGTGTGG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1159889458_1159889469 | 8 | Left | 1159889458 | 18:73940278-73940300 | CCCCCACACTCAGACACCCAAGG | No data | ||
Right | 1159889469 | 18:73940309-73940331 | ATTCAGCAGTCCAAGTGACTTGG | No data | ||||
1159889458_1159889470 | 13 | Left | 1159889458 | 18:73940278-73940300 | CCCCCACACTCAGACACCCAAGG | No data | ||
Right | 1159889470 | 18:73940314-73940336 | GCAGTCCAAGTGACTTGGCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1159889458 | Original CRISPR | CCTTGGGTGTCTGAGTGTGG GGG (reversed) | Intergenic | ||