ID: 1159889458

View in Genome Browser
Species Human (GRCh38)
Location 18:73940278-73940300
Sequence CCTTGGGTGTCTGAGTGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159889458_1159889469 8 Left 1159889458 18:73940278-73940300 CCCCCACACTCAGACACCCAAGG No data
Right 1159889469 18:73940309-73940331 ATTCAGCAGTCCAAGTGACTTGG No data
1159889458_1159889470 13 Left 1159889458 18:73940278-73940300 CCCCCACACTCAGACACCCAAGG No data
Right 1159889470 18:73940314-73940336 GCAGTCCAAGTGACTTGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159889458 Original CRISPR CCTTGGGTGTCTGAGTGTGG GGG (reversed) Intergenic
No off target data available for this crispr