ID: 1159889460

View in Genome Browser
Species Human (GRCh38)
Location 18:73940279-73940301
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159889460_1159889470 12 Left 1159889460 18:73940279-73940301 CCCCACACTCAGACACCCAAGGG No data
Right 1159889470 18:73940314-73940336 GCAGTCCAAGTGACTTGGCAAGG No data
1159889460_1159889469 7 Left 1159889460 18:73940279-73940301 CCCCACACTCAGACACCCAAGGG No data
Right 1159889469 18:73940309-73940331 ATTCAGCAGTCCAAGTGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159889460 Original CRISPR CCCTTGGGTGTCTGAGTGTG GGG (reversed) Intergenic