ID: 1159889462

View in Genome Browser
Species Human (GRCh38)
Location 18:73940280-73940302
Sequence CCCCTTGGGTGTCTGAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159889462_1159889469 6 Left 1159889462 18:73940280-73940302 CCCACACTCAGACACCCAAGGGG No data
Right 1159889469 18:73940309-73940331 ATTCAGCAGTCCAAGTGACTTGG No data
1159889462_1159889472 30 Left 1159889462 18:73940280-73940302 CCCACACTCAGACACCCAAGGGG No data
Right 1159889472 18:73940333-73940355 AAGGCTGAAAGCCAAGTTGCTGG No data
1159889462_1159889470 11 Left 1159889462 18:73940280-73940302 CCCACACTCAGACACCCAAGGGG No data
Right 1159889470 18:73940314-73940336 GCAGTCCAAGTGACTTGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159889462 Original CRISPR CCCCTTGGGTGTCTGAGTGT GGG (reversed) Intergenic