ID: 1159889468

View in Genome Browser
Species Human (GRCh38)
Location 18:73940295-73940317
Sequence CTGCTGAATTCGTCCCCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159889468_1159889473 24 Left 1159889468 18:73940295-73940317 CCAAGGGGGGACGAATTCAGCAG No data
Right 1159889473 18:73940342-73940364 AGCCAAGTTGCTGGAGATCCTGG No data
1159889468_1159889469 -9 Left 1159889468 18:73940295-73940317 CCAAGGGGGGACGAATTCAGCAG No data
Right 1159889469 18:73940309-73940331 ATTCAGCAGTCCAAGTGACTTGG No data
1159889468_1159889472 15 Left 1159889468 18:73940295-73940317 CCAAGGGGGGACGAATTCAGCAG No data
Right 1159889472 18:73940333-73940355 AAGGCTGAAAGCCAAGTTGCTGG No data
1159889468_1159889470 -4 Left 1159889468 18:73940295-73940317 CCAAGGGGGGACGAATTCAGCAG No data
Right 1159889470 18:73940314-73940336 GCAGTCCAAGTGACTTGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159889468 Original CRISPR CTGCTGAATTCGTCCCCCCT TGG (reversed) Intergenic