ID: 1159889469

View in Genome Browser
Species Human (GRCh38)
Location 18:73940309-73940331
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159889467_1159889469 -8 Left 1159889467 18:73940294-73940316 CCCAAGGGGGGACGAATTCAGCA No data
Right 1159889469 18:73940309-73940331 ATTCAGCAGTCCAAGTGACTTGG No data
1159889468_1159889469 -9 Left 1159889468 18:73940295-73940317 CCAAGGGGGGACGAATTCAGCAG No data
Right 1159889469 18:73940309-73940331 ATTCAGCAGTCCAAGTGACTTGG No data
1159889458_1159889469 8 Left 1159889458 18:73940278-73940300 CCCCCACACTCAGACACCCAAGG No data
Right 1159889469 18:73940309-73940331 ATTCAGCAGTCCAAGTGACTTGG No data
1159889464_1159889469 5 Left 1159889464 18:73940281-73940303 CCACACTCAGACACCCAAGGGGG No data
Right 1159889469 18:73940309-73940331 ATTCAGCAGTCCAAGTGACTTGG No data
1159889460_1159889469 7 Left 1159889460 18:73940279-73940301 CCCCACACTCAGACACCCAAGGG No data
Right 1159889469 18:73940309-73940331 ATTCAGCAGTCCAAGTGACTTGG No data
1159889462_1159889469 6 Left 1159889462 18:73940280-73940302 CCCACACTCAGACACCCAAGGGG No data
Right 1159889469 18:73940309-73940331 ATTCAGCAGTCCAAGTGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159889469 Original CRISPR ATTCAGCAGTCCAAGTGACT TGG Intergenic