ID: 1159889470

View in Genome Browser
Species Human (GRCh38)
Location 18:73940314-73940336
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159889460_1159889470 12 Left 1159889460 18:73940279-73940301 CCCCACACTCAGACACCCAAGGG No data
Right 1159889470 18:73940314-73940336 GCAGTCCAAGTGACTTGGCAAGG No data
1159889458_1159889470 13 Left 1159889458 18:73940278-73940300 CCCCCACACTCAGACACCCAAGG No data
Right 1159889470 18:73940314-73940336 GCAGTCCAAGTGACTTGGCAAGG No data
1159889464_1159889470 10 Left 1159889464 18:73940281-73940303 CCACACTCAGACACCCAAGGGGG No data
Right 1159889470 18:73940314-73940336 GCAGTCCAAGTGACTTGGCAAGG No data
1159889462_1159889470 11 Left 1159889462 18:73940280-73940302 CCCACACTCAGACACCCAAGGGG No data
Right 1159889470 18:73940314-73940336 GCAGTCCAAGTGACTTGGCAAGG No data
1159889467_1159889470 -3 Left 1159889467 18:73940294-73940316 CCCAAGGGGGGACGAATTCAGCA No data
Right 1159889470 18:73940314-73940336 GCAGTCCAAGTGACTTGGCAAGG No data
1159889468_1159889470 -4 Left 1159889468 18:73940295-73940317 CCAAGGGGGGACGAATTCAGCAG No data
Right 1159889470 18:73940314-73940336 GCAGTCCAAGTGACTTGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159889470 Original CRISPR GCAGTCCAAGTGACTTGGCA AGG Intergenic