ID: 1159889472

View in Genome Browser
Species Human (GRCh38)
Location 18:73940333-73940355
Sequence AAGGCTGAAAGCCAAGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159889468_1159889472 15 Left 1159889468 18:73940295-73940317 CCAAGGGGGGACGAATTCAGCAG No data
Right 1159889472 18:73940333-73940355 AAGGCTGAAAGCCAAGTTGCTGG No data
1159889467_1159889472 16 Left 1159889467 18:73940294-73940316 CCCAAGGGGGGACGAATTCAGCA No data
Right 1159889472 18:73940333-73940355 AAGGCTGAAAGCCAAGTTGCTGG No data
1159889462_1159889472 30 Left 1159889462 18:73940280-73940302 CCCACACTCAGACACCCAAGGGG No data
Right 1159889472 18:73940333-73940355 AAGGCTGAAAGCCAAGTTGCTGG No data
1159889471_1159889472 -9 Left 1159889471 18:73940319-73940341 CCAAGTGACTTGGCAAGGCTGAA No data
Right 1159889472 18:73940333-73940355 AAGGCTGAAAGCCAAGTTGCTGG No data
1159889464_1159889472 29 Left 1159889464 18:73940281-73940303 CCACACTCAGACACCCAAGGGGG No data
Right 1159889472 18:73940333-73940355 AAGGCTGAAAGCCAAGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159889472 Original CRISPR AAGGCTGAAAGCCAAGTTGC TGG Intergenic