ID: 1159897048

View in Genome Browser
Species Human (GRCh38)
Location 18:74007381-74007403
Sequence TTTTCTTCTTAATGACAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159897048_1159897053 27 Left 1159897048 18:74007381-74007403 CCCCATTGTCATTAAGAAGAAAA No data
Right 1159897053 18:74007431-74007453 GTAGGTTTTTATTTCACTTATGG No data
1159897048_1159897051 9 Left 1159897048 18:74007381-74007403 CCCCATTGTCATTAAGAAGAAAA No data
Right 1159897051 18:74007413-74007435 TTTTTGCTCACTTTCCTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159897048 Original CRISPR TTTTCTTCTTAATGACAATG GGG (reversed) Intergenic
No off target data available for this crispr