ID: 1159897053

View in Genome Browser
Species Human (GRCh38)
Location 18:74007431-74007453
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159897050_1159897053 25 Left 1159897050 18:74007383-74007405 CCATTGTCATTAAGAAGAAAAGC No data
Right 1159897053 18:74007431-74007453 GTAGGTTTTTATTTCACTTATGG No data
1159897049_1159897053 26 Left 1159897049 18:74007382-74007404 CCCATTGTCATTAAGAAGAAAAG No data
Right 1159897053 18:74007431-74007453 GTAGGTTTTTATTTCACTTATGG No data
1159897048_1159897053 27 Left 1159897048 18:74007381-74007403 CCCCATTGTCATTAAGAAGAAAA No data
Right 1159897053 18:74007431-74007453 GTAGGTTTTTATTTCACTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159897053 Original CRISPR GTAGGTTTTTATTTCACTTA TGG Intergenic
No off target data available for this crispr